Description :
From Genome Similarity Track
Location :
Scaffold_1813:4458- 7027
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1813-fgenesh-gene-0.1Glutamate synthase
Pytiw_DAOMBR242034maker-piw_contig_1813-snap-gene-0.4Gene of unknown function

Sequence
2569 bases(100 bases per row)
CGTGTAAAACCAGTGCATCATCGAGCTCCCCGCAATTCATTCCTCGAAAGAATTGACAAATGAATTGATCGTTGGCGATTCATCTGAAGTTTGCGGAACC
CGCGGAACAAACAAAAGGCACTCATTCCGCATTTTGACGAGACGCCCGCAAGCAGCAGCACGCGCATCCGCATCGCTTCCCCGTTTCCTCCTTCTGTGTC
GCTTCCTGTGTCTGCCTGTCGCCAGAGAACGTGCGTCCATCTGAGCCAACGTCTGTGCGTCTGTCGCCATTTCCGTCCTCTCTCGCACGCGTTGAAGTAG
CAGAACGAAGCGATCTTTTTTTCGATTCCGAGACCGCACCACCACCATGCAGTCGACACTCCGCACGAACGCCGCGCGTCTCGCCGGCCGCAGGCAGTTC
TCCACCACCACGAGACGCTACGGCAGCGCAGTGAACGTCAAGGAGCAGGAGGATCTCTTTGAGAAGCGCGACGGGTCCGTGGGCAAGATCGTGAGCGAGC
GCGCGTTCATCGAGTTCAAGCGCCAGCCAGATCCGTATCGCCCAACATTTGAGCGCCTCCACGACTGGAACGAGATCAACACGGACACGCGCGAGCCCAT
GGAGCGCAAAATCCAGGCTGCGCGCTGCATGGACTGCGGCACGCCGTTCTGCCAGACGAACACGGGCTGCCCCGTGAACAACCTCATCCCCGAGTGGAAC
GAGCTCGTGTTCCGCGACGAGTGGAAAGAAGCGATCGACCGACTGCACAAGACCAACAACTTTCCCGAGTTCACGGGCCGTGTCTGCCCTGCTCCGTGCG
AGAGCGGCTGCGTCGCTGGCCTCGTCGACGACCCGATCACCATCAAGAACAACGAGTACGCGATCGTCGACCGCGCGTTCGAGGAAGGCTGGATCGTGCC
TCGCATCCCACGTCGCAACGGACTTCGCGTCGCTATTGTCGGCTCGGGGCCAGCGGGGCTTGCCGCTGCGGACCAGTTGAACCAGAAGGGCTACCATGTG
ACAGTGTACGAGCGTGAAGACCGCGTGGGCGGATTGCTCATGTACGGCATCCCCAACATGAAGCTGGAGAAGAAGACGGTGAACCGAAGAGTCGACTTGC
TGCGAGAGGAAGGCATCAAGTTCGTCACGAACGCGGAAATCGGTGTGAACATGCCAGTCAAGCAGCTCCAGAGCGAGAACGACGCGGTGGTGCTCTGCCT
CGGCTCGACAGTTCCTCGCGACATGGAAATCCCTGGCCGCGATCTCAAGGGAATCCACTTTGCGATGGAGTTCTTGACGAAGAACCAGAAGCGATTGATG
CTCACGATCGACGGCAAGCTCCAGAGCGGCTGGGACCGCAACTTCATCACGGCGGAGGGCAAGGACGTCGTCGTCATCGGCGGTGGTGACACCGGCACGG
ATTGCAGTAAGTGACATGTGTTTCATACTTGTTGGTATTGTTGTTGTCCAGGTTTTCTGATATCCCGCTTGTTTTGTGTGCTCTATTGCAGTCGCGACGT
CCATGCGTCACCGCTGCAAGTCAGTCACAAACCTCGAATTGAACCCACAGCCACCTCCGTCGCGTGCGAGTGCGAACCCGTGGCCAGAGTACCCTCGCAT
CTATGGTGTCGACTATGGCCACGCTGAAGTCCGATCGGTATTCGGCGAGGACCCTCGCAAGTACAGCAAATTCACGAAGGCGTTCAAGGGCAACGACAAC
AACGAGATCACGCACGTCGTCACGCAGTTGTCGGAGAAGGACCCTGAAACCGGTATGTTCAAGCCAGTGGAAGGCACAGAAGAGGAGATCCCATGCGACC
TTGTCTTGCTCTCGATGGGCTTCCTCAACCCAGAATTGAAGCTCGCCGAGCAGCTCGACTTGGAGGTCGACCAGCGCCGCAACATTCGCGCCGCCTACGG
GAATTTCCAGACCTCTCAGGAAGGCGTCTTTGCTGCTGGCGATTGCCGACGAGGCCAGTCTCTCGTGGTGTGGGCGATAAACGAAGGCCGAGGCGTCGCG
GACGCTGTTGAGAAGTACTTCTTGGCAGAGGGCTTCCAGCCAGAGGTGTCGCAGAACCAGCGCTTCGGCTAAGAGACTGAGCGAGCGATGCGATTGAGTC
GGCGATTCGAAAACGAGAAGAGGGAGGGTGAGGTTTGTAGTGCTCGAGGGAAAAGGTATAATGCGAAAGCTGTTTATTGGAAAATGTGGACGTGGTGCTG
TATTGACTAGCTAACGGGAGCAGGTTGGTTCTATGAAGAAAGCAATGATGCAAGCAAAACTGGAGTAGCAAAAATGTGCGGCGAGCCACGAAGCACGATG
GAAAGCTAGAGTCTTATGATCGGCACAAACTGCAGCAACTCGGTGATGCCGTGGAGTCGCGATTTCTGCTCCGCCTCGCGAGAATCTGAGTTGCTGCCGC
CTCTGCCGTTGTAGCGTAGGTCCAAGATGCGGACGCCTTTGAGCATCGAGATGTCATGGAGTCGCTTGCAGTCGCTCAGATTAAGTACGTGGACGCGCGC
GAGTGCCGAGACGTCGTCGATCTCCTCACACCCAGACAGGTTGAGCGAGTGGACACCACCGAGCGCCGA