Description :
From Genome Similarity Track
Location :
Scaffold_18:44574- 46078
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.27E3 SUMO-protein ligase NSE2

Sequence
1504 bases(100 bases per row)
ACCGTCGCGCGAGCAGCACTTCCATCTCCACATCGCGCTCCAACTTGTTGAAGGCCAGCTTTTGCGGGCAGCCTGTCGATCACACCAACAAACTATCAAC
TCCGAGGACTCCCAACCCCAGCAGGCACTGAGCGACTGACCTGCCACAGGACACTTTTTGCTGCGCTGTAGATGCGAGCGGATGCCCGGCTCCGAGTACG
TGTGGCCGCAGCTCGGACTAACGACAGCAATGCAACCAATCAGTGCGAGTCAACCACTTGTCCCAGCCAAGCGCCGGTCAGTGCGACGTACTTGCGAAGC
GGGTTGGTCATCTCGAGTTGTGTGACGGGGCAAATGAGGCTGCGCGTGCTCTCGCTCTCCTGGAAGACCACGTCGGCGTCCGCATCCGTCTCCAGCTCAA
TCTGTCCACGCAACACGCGTTCATAACGGCACCTGTTTGGTCAATCTCGGAAACTAGAGCAGCACGCACGCCGGCCTTGTCGCAGAACTTCTTGTAAAAC
TCGTGGTTGGCGACGTTCATGCGGGGTTTGGCGATGCTGTCCGCGAGCATCTTCTCGATCTTGGTCGGGTCCTGCAATAGATGTCATTAGCCCACCACCA
CAGCCCAGCAACCCAGCCAACGTGACACGCGCGTACAATGTGTCCGCTGTCGACCAGCTCGCCCATCTTCTCGAGCTGCTTCTTGTAGCGCGAGATCTGC
GCCTCGAGCACCGCAAACTCCCGAGCAGTCTCATCGAGCTGCGAGATGTGCTCCTGGTCGTCCAGGTCGTGCAGAAAACCCGCCGTGAAGCACAGCGAGT
CGACGCTCTCGATCGTGTACTTGAGCAGGTCCATCGTCTGCTTCCGAGCGCCGTACACGCCCATCTTGAGCGCCGCCGGCGTCGCGCGCGTGATGCCTGC
GGCCAGCTCCTCGTTCATGGTGGCAGTAAGTGTGTTTTGGTTGCTTTATTTCGTTTTGTTTTTCGCGGGAAAGAGGAGTAAATACCATGTAACTGCATCA
AACAGTCATTGATATTTTGATAAATTGCGATTTGATGACATCTAACTAACTGCAATCGGAACCACTTTTCAACCTAAAGAGAAGGAAGATGGCGTTCGAT
GCAGCGGGGGCGTCGAGCCTGGAGCAGTTCACGCTGCTGGCCAAGAACGCGCGCGGCCGCGCGTGCGTGGCGCTGGTGCAGCAGGTGCTCTCCAACAAGA
AGCTGTTCGTCTTCCGCGAGCTGCTCGACATGCCGAATATCCAGGCGCTGCAGGGTTCCGAGTACCAGGGCCACTTCGACCTGCTGCGGATCTTTTGCTT
CGGCACGTACGGCGACTACCTCGGTGCGTTGCGTGCTTTTATCGTGGCTCCTCGTTGTGTACATATATCTCCACGCAAGGGCTGATGTTAGGATGATTGG
TGTGAAACGCAGAGCGGAAGCAGGAGCTGCCGGCGCTGACACCGCAGCAGGTGCAGAAGCTGCGGAAGCTCACGGCCGTATCGCTCGCCCACCGCTACAA
GGTA