Description :
From Genome Similarity Track
Location :
contig_120:44571- 46097
Sequence
1526 bases(100 bases per row)
AGCGGATCGGCTCAGTACTGTAGCTATTTTGCTTCAGCGTTCGGTTATGTCGGGGTATCGAAACGACGAGGCTTATTGAGAGGGACCTCTGTGCTGTACG
TCCACCTGCGAGCGTACGCCGTTGGCCCCTTCTTGGTACCAGTGTTCAGCGAGGCCTTTTCTGCCTGTTAATCCATGCCGCTGTCGGAGGTTTCAACGCT
CGCTACTGTGGAGCTGCTGGACAGCTCTCTAGTAACACCGATGGGGTCCGCGCATCGGCCAGACCAAGAAACTGGCGACTGAGTGAGTGCTGCTGAGTGA
GTGCTGCTGAGTGAGTGATGCCTCCACGAGCGCATTGCGGCTTTTGGAAGTTGCTGTAGGCTACATATCCTTTTTCTATCTATACGGTTCGCATCAAGTA
CGATTGTGAGTGATAGTTTCTCTTCAAAGAGAGTCGCCCGCCTGTGCGCCGTCATCACCTTGAAGCGGAAAGGAGGGGAGGTGATTGGCGTAGCGCGCGG
CGATGCCAGCACTGTCATTGCGCACTTGCAGCGAAGGCAGCTCGGCGAGGTCGACGGAGCGGTGGCTTGTACGGGTACCGGCACATGTATGTACAGCACG
CATCGACACGAAACGCGGCAACCCACCGTCTACGGGGACGGATTGGAGGGCGGAATCTGTATATCGCTTGAGCCAGTACATGGACCGGTAACAGTCAGCC
TGCCTTAATCCTACCAAAAAGTAAAGATACATGTAGATATCCGCCAAACTCTTGGCGGTATAGTTATTGCTTGCATAAGGTGGCTTGCTGTCGTTTATGG
TAATGGTGAGTTCGATCTAATATGTACATGTTATCAAGATACTTCACTGTACTGTACTTCATATAAATTAATTTTCCGGTGCAATTGTTTTCAATCTTCT
TCAGTTTTCTTTTTTGGCGACTAAAATCGCTTTTCTTGTTCGATGTCGACGCTCGCTGTGCGAGTGCATGCCGACATATTCACTTTTCGCTGTGGATGCG
ATTACTAATATGTATTGAATCCAGTCCAGACGACGTTGCCATTATTTTAATACCTACGTGTATAGTATGGAGAGACGTCCCATACTGCAGCGCTAGTAAG
GCCACTTGGGCCAGTGACTTGTCTGTCGTGTGCAAAAAGCTTGATCTCCACGAAGGAAACGAATCCCCGCTGTAGGAATAGTCGAGAGAACACCGACTAT
GAAGGTCTCAGACAGCGTGTCATCGCAAGCCACCGCTCCGTCGACCTCGCCGAGCTGCCTTCGCTGCAAGTGCGCAATGACAGTGCTGGCATCGCCGCGC
GCTACGCCAATCACCTCCCCTCCTTTCCGCTTCAAGGTGATGACGGCGCACAGGCGGGCGACTCTCTTTGAAGAGAAACTATCACTCACAATCGTACTTG
ATGCGAACCGTATAGATAGAAAAAGGATATGTAGCCTACAGCAACTTCCAAAAGCCGCAATGCGCTCGTGGAGGCATCACTCACTCAGCAGCACTCACTC
AGCAGCACTCACTCAGTCGCCAGTTT