Description :
From Genome Similarity Track
Location :
Scaffold_162:44570- 45981
Transcript NameFunction/comments
Phyra_85312Hypothetical protein

Sequence
1411 bases(100 bases per row)
CTTGCGCGAAACCTCACCGAAGAGTTTGTAACGGGTCGATGGCGACAGCGGCCCTCGGGCAAGATGGACGGCACAGCGACGGCGCGACGGTGGCTGGCGA
GGAGATGCGGTGCGGCAGAGCAGACGCAGCTGACGGAGATGAGTGCGGCGCTGAAACCGGCGAAGTGAGCGAAGAGGCGGACGGAGGGGAGGTATTTGTG
TGAGACGGCGGCGGACGAGACAGAAGCACCGAAGGTCCAGGAAGGTCAGGCGCAGTGGATATGGCGTGCGTGCGTGCGGGTGAAGAACCTGGACTAGAGC
GCAGTTGGCGAATCGCAGCCGAGGCAAAGGGCTCAGTCTCGAACTTGCAGCCTGGAGCGCAAGCGGGGACAAGCAGCAGACGGCGGACTTCCTGCCAACG
ACGGTGAAGTGGAAGCAAAGGACGGCGGACTTCCTGCCAACGACGGTGAAGTGGGAGCAAAGGACGGCGGACTTCAGTCCAGCGACGAACGGAGCGAGCA
AGGGGTGCGAGGTGCCCCGAGTTGGTCGACGGCTGCACGTAGGGCAGGCACCACTGGGTGTACGCCCGAGTGGCTAGACGAGCGCGGCGACTGGCGCCAG
GTGGAAAGCCGCCGAAGGTGTCAGTGGTAGCTAGCAACGGACGGAGTAGGCGAAGGACGCAGAGTAGTTGACGGTATAATAAAGTAGGTGCTTGTCCAGC
AGGACGAGTGCCGGCGCAGGGGTCCACAGTTGGTCCCCTGACAGCCAGCACACGGAGTACGAGTCACTAAGGACGGCAAACTGAGTACGCGACCAGCCCG
GCGTGCAGGGTTACGGCAAGACACGTTACATGGTGGTCATACAGGGGCCTCTACGACAAGTGAATACGCTAGGGGCTTCCAGTGGGTCGAACACACAAGA
ATCGACGATGACAATGACATTCACGCAGCCAGCGCTAGGAGTTACGACGCGATCGGCGTCGAGGACACGGACTGTACGAACAAGGACGCCAGGAGCTGAA
ACGACAGTACAACCGGCTGCACCCACGAGTGCAGCGACAGCTAGAGGAACCCCACCAGTACCCACGCCCACTGTTCTGGGAGCTGCGAGGTTTAGTGACG
AAGCAGGTAATACGACGAGCGACGATGTGGGCTCGGGCATGACAATGCTTAACACCGTGCTACAGCAGCTGCTTACGACCATCGCACGCTTGGACACAAG
AGTCAATAGCATCGAGACGACGGGAGCTGCGGCACCAAGGCCATCAGCAACGCCAGGCAGCAGGCAAGCAACGGCTCAGCGGGCACCAACAAGAAGTCGA
GCAAGTGAACCAGGCGATGGCGACGCTTCAAGCAGTACGGATTCGCCAGACAGCTCGCACGGAGACGACGCGAGCAGCGATTCACCAAGCAGCGACCCGT
CGAGCAGCGAC