Description :
From Genome Similarity Track
Location :
Scaffold_364:4457- 8410
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_364-snap-gene-0.12ATP-binding Cassette (ABC) Superfamily

Sequence
3953 bases(100 bases per row)
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTACTCCAGACGCTTTACGTGGAATATGCTGCGCAAGCAACGTGAA
GGACGAGTGATCGTACTCACGACCCACTTCATGGACGAGGCAGATGTTCTTGGTgaCCGCATTGCCATCATGGCCGATGGAAAGCTACGCTGCGTCGGGT
CGTCGTTGTTCCTCAAAaCTCGCTACGGCGCAGGCTATAACCTGACCATGATCAAGGCCAaCGATGCTGACTTCCAGATCTCCCAGATTGAGGCCTTTTT
GACGACTCACATCGGCAGTGGAGAGGCCAAGCTTGCAAGTGACTCAGGATCTGAGGTGGTATTCACGCTCCCAACGCACAGCTCAGCCAAGTTCCCGGCT
CTGTTTGATGCCCTTGATCGCGAGATGGagTCGCTaTGTGTCCGAAACTATGGAATCTCGGTGACTACCCTTGAAGATGTGTTCCTGCGCATCGCACACG
ATCGcGACCACGACCATGACGgCCTACAGCCGCCAGTCATCAATCCTACTCATGATAGGTCCCAGCTGTCGACCCCATCATTTGGCTCTCAATGGGCCAC
ACAGTTGCGCAAGCGATGGTGGATTTCCAAGCGTGACAAAAAGTCTCTGATCAATGCCATCGGCATTCCGCTTCTGTTTCTGATCATCATGGCTGCACTA
CCAACCATTGAGGTATCAACGTTTTTGCCTGACTACGCTACGAGTTTCCCGTCACAGGCGCAGCAAGAAACTTGCCCTGCTCAAAATGTCACCGAGAATG
AGCTCACCAACCGCGAGATGGACTGGTGCCAGTCCCAGGGCTTTGCTTTCTGCTCTGTCGGTCTTATTGACTGTGAGGCGTCTGTTTGCTGTGATGCTAC
CGACTATAGATCGCCCTTCTACGCGTGTAGCACGTGCAGCACGGATCTTCTTACCaGTTCAGGGGATGCACCGTGTTACAATTCCATGTGCATGCGCCGC
AACGGGGCCAAGCTTCAAGTGGCATTGAACGCGTTTGTCGTGGCGATGATCACGATGCTCGCGTTTGCATTCGTTCCAGCAGCGATCATTGCATTCATTG
TTCGAGAGAAGGACCCGATtcAGGATGCGAAGGCTCTTCAGTGGATTTCTGGACTATCGCTCGATGCCTATTGGACTGCAAACCACACACACGATCTTAT
CGTCATTGCTGTGTCGGTAGTGGCAGCGATTATtACCGTCCcAATCGCtAGTCCGCGTGCcATGAGTGAGTCCATTGAAGTGTTTGGTGTCGCTCTGCTC
GTCATCAGTCATGCGCTGTGCGTTATCCCTATGAGCTACTtGTACTCGCGACGCTTTGTCAaGCACGCCAGCGCTCAGACGTCGATGCTTGTGTTTGCAC
TTGCATCGGGCGGCCTGTTGAGCATTTTCTCTTTCCTCTGCCGGGTTGTCGACTTCAAtATGAGCTCGTCGCTGACGCTCTCAGGACTCGATCGCGATTA
TTTGCGCTGGTTCTTCATGTTTTTCCCTGGCTACGCTCTCAACAATGGCATTTACGAGATTGCgaCACGCAAGATCACTCGCGGATCGTTGTATGGAAGT
AACTGGCGGGTGCGGAACCCACAGTCATCATTCTTCGGCCTATTCcGAGGATTCGGtAAGGACGAAAACTGTACTGCaTGCTGGAATCGTGACACACCCG
GTTGCTGTgTACGTGAGACGATGGATTTCGATGTGGCGCTGGCTCCTGTCATCTACATGTTGCTGGAGGCTGTTGTGTTCaCAGTGCTGGTATTCACGCT
GGAAAAACGaGCCCTgAaGGCCAAACAGAATCGAGACGATACAATCAATTCGAACgACAAGGACACGGAACAAAGCGAGGAGAGTGAGGAAGAGGAAGAC
GAGGATGTTGTCGCAGAACGcGAGCAATTAGATCGACGTGGAGATGACGCAACGACGGATGCAATTGCCATTCGCCGTCTACGTCACCAATATCCGGACG
GTCGTGTGGCGCTGCGGGGACTGAGTCTAGCGATccgcAAaGGAGAGTGCTTtGGGTACTTGGGAGTGAATGGGGCAGGCAAGTCGACGACCATCAAAAT
CTTGACACGGCAGGTGgCAGCTACTAGTGGTGCGGTCTCTTTGGCAGGTCGCGACATTACGAGTCGCAAGCTCACGACCAAGGGTCAGGAGCACCTGATC
GGGTACTGCCCCcAGTtcGATGCTCTGCACGACTTGCTCACAGTCGAAGAGCAACTCATTCTCTACGCTCGCATCAAAGGaGTAGCCGAAGACCGCGTCA
TGGACGAGGTGAACGACAAGATTCATCAGCTAGGGCTGGACGAGTATCGATCCAAGCTGACGCGAGGCTTAAGTGGTGGCAACAAGCGCAAGGTATCGAC
GGCAATAGCACTCATGGGCGGACCGCCGATCGTCATCCTCGACGAGCCTTCCACAGGAATGGACCCCAGCTCAAGGCGgAAGATGTGGAACGTGATCGCC
cAGACATGCTctACACACCACACGAGTGTCGTTCTGACAACACACAGCATGGAaGAATGCGAGGCGTTGTGCTCACGAGTGGGTATCCTCGTGCGGGGCG
AGCTGAAGTGCCTCGGAAGCGTGCAGCATCTCCGTCACAAGTACGGTCGTGGCTACACTGTGGACATCAAACTTAACGGAGAGGCATCTCGGGAGCGGAT
ACAAGCAATCGAACGTCATGCCCGCAACATCACTGAAGATGCAGACGCTCTCGACGAAACCACGCTAGAGCGTTTGTGCGAAGTTCtcGATGCGGCCAAA
CGCTTCGACGAACTGACAGGCGACAAGGATGGAGGCAaTGGTGACTGGTGGGACGCTGTTAGCGACACTGGCGTCCGCACCATGTCGCTTACGCGCTTCT
CAGCGTGGTGGCTCACTCATGAGCGACACGAAGCGCTTCTCGAGTTCATGATGCGCCGATTCCCAGGCACGACTCTCGTTGAACGACATGGGGACCATGT
ACGACTCCATATCCCCAAGCAACCAACTCAGGATGCGGTGATGCTGAGACCCAAGGTGATCTTCGAGGCCCTGGAGATCGAGAAGCAGTCGCTAGGCGTG
CAGGAGTACAGCGTAAGCGACACATCGCTCGAGCACATCTTCAATCGCATGGC