Description :
From Genome Similarity Track
Location :
Scaffold_259:44569- 48914
Sequence
4345 bases(100 bases per row)
GTCCGACAGACACGAACGTGGAGCTCACGCCATGTAAGCGAAGCCCCTCCCCCCAGTATTCGTCATTTTCATAAAGGCTAATTCAATTGCAGTTCTTCCG
TCGGTCGTGTATGACAATTTGGATGGGGACAGGACGGCGAGTCTGGTGACTCCGAGCGGTGGAGTACTTGTCGCCCACGTCAACTACAGAACTGTAGGTT
ATCAGTTTGCTGACCAACCATGGCATTGGTATTAAAAACACCTAACGCATTGTTGTTTGCCATTACCACTCACACCAGGATGCTCGATATTACACGGAAA
ATGTACTCGAATCGCGACTAAATTACCCCAGTACGTATCTGGTTATTGCAATTGGAAATGTAGAACAGCAACTGACACACTCGAATGCTTTCCGTTTTGA
AGCTTCACTGAGTCCATACGCAAAGATCTCTTATGCGTCAAAACCATTCTCAGCAACAGCGTACAAAGCTGGGCAAGGGCCAACTTTTCTGAAAGACTTT
GACGCTGCCCCTGCACCCGTGGAAAGCGACGGGTTTTGTGAGCGAGAACTATCTGTACTGGGACCTTTATTGAACACTCAGAGCGATCTTTGCGGCAGAT
TCAAGCAGGTGGACACAAACGTGGGTTTTCTGATGCAAGTGGACTTTGTGGAGTCTAGCCCAGTTAATACAAGCTGGTCGTGGTATTTAGGTCTGCCCTT
TCGGCTCGGTAACGGCGCTGTCGTGGTCCTGGATGGTGTGGTGATGCAAGATTTGATGGGCAAGACTGGGTATTGGAAAGGTGTCCTCACAAAAACCACC
CAAGTTGACATGAAAATCACACCCGGTTTTCATGTGTTGAAGGTTTACGGATTATCTGCAAAGTTTGAAGCATCGAGTCTATATTTCAGTCGCGAGGGAT
CCAACCCGGTACTCGTTTCCACCGCTGCTCTCATTACGGAACTCACAAAATGGACTCCCTTTGCTGCTCCTGATTTTACGATATCAGCTACGCTTACGGC
TGAACAAGCTAACAAAGCTAGCAATGTTGGCAGAGGGGTATCAGTACTACAGTTCCAAAGTGCACCTGTTGACGGACGCTTCGCATTGCACTTAGCAGCG
CTATCGACGACAGATACCCCGAGTGCTAAGCTAAATACCTCGTCCTTAGTGTCCTTCTCGTTTCTTCCAACTTCGATGTGGGCTAGTGCAAGGGCATCTC
AAGTTTCTTTTGCTACAGCGGTTAGCACACTATGGAGTGCAATACCTGGCTTAAGTATGACCCTGACGCCTGCAACAAGTGGGGTTCTCATGTGTTCTTT
TACGGGAAGATTTTTCGTGGACAAAAGTACTGTGAAAACGTTTCGTCTCGACCTTGGGTTCGGCACAAGCACTACATCAGTCACCTCTCAGTTTCGCTTG
GATGAATCATTTATTGACCCTTCTGGTGTGCCTCTTGAATTTTCTTACTTTACTAGCGTTCCAACAGCCAGCGCACTGAGTATCTTGCTCAGTTATCAAT
ACCAAGGAACGAAGACTGGAAAGATTATAGGTAGCAGAACGACAGCCACATTTGTTCCAGGGGGTTCATTAGCTACTGAAACCTTGAGCGACAGCACGGC
TGCCTTGAATAGCACGATCTTCTCCAAAATGGTAGTACTCTCTTCCTCAAGCACATTGATAATTCGTGTTGGTGGTACCATCTGCCGCAATGCAGCCACC
GAAGTATTTCGTGCGCGCATATCGAAAAACGGAAACCCGATCTTTGATGGAGATTTCTCTTCAGTGGCGGGGACAGTGTTGTCAGGAATGTGTGAGCCTT
TGACAATGCACTCTATTATCGATTGTGTTGCAGGCTCCCACACAGTAACAGTTGACGTTAAAACATCGACGAGTTCTGGGTACCAGTTAAAAGGGGTGCA
ACTACAAATTGTCACGGTCGAGAGAGGTGCCTTGCTGTCGCAAGAAATGTGTCAGTCACGCTGTTCACGGCATGGTCTATGCCGAGTAGGCGTATACAAC
ATTGCTACGAAGGCATGCAACCTTTATATGACTCGCAATTCGTCCTCGTTAGTGACAGATCCAACTCGCGTGGCGTTTGTAAGAACCCAGGAAGTGGTTA
TTTCGGGGAATGCGTGGACGATTCTTCACAACACAAAGTGGGCACTTGGACAGAATGTATCTCTTGCAACCCCATGCAAAGGCGACGCGTGCGGAACTGG
TATTTGTTCTCAAACGTACACATTGAAAGAGCGCTGCCGATGCATTTGCCAATCAAGCAGTGACTGTGTAGGCTTCGCAAATACGGATGGAACATGTTAT
GCTATCACAGCATCAGACTTTCGCCAAAGTGTCCAATTGGGCACATATAATACCTCGGGTGCCGCTACTATTCATTTGAATATGCCTCAGACTTGCCACG
CTATCAAAGTCGATGCCCCAGATGCGGCAACTGGACGATATGTCATAGCGACGTCAGCAGGAATATATGATGCGTTTTGCAATATGACCGCTGATAGCGG
TGAGGGATACACGATTGTGCCGTGTGATTTGGGCATCAGTGACATCAATTGTCTGAGCAGTGCTAGCCCAAAAGACAGTGATAGTTGTAAGATCATGGGT
CTTCAACAAGTGGTACCGCGGTCTTCGGGGCATTTTATATCAATGCACCGAAAATATGGAGCACTCTTTTTCTCGACAGTTCCCGGAGTAACCAATGCCT
ACGTTGGCGATAGTATTGACCTACCAAGTGATGACGAAACTGTGCTCGATTGGACAGCAACCGATGGAGGAAAATGGTGGTTACGTGATAACGGTAGCAT
TTGTGATACTGTATCGCCTGCGAATGCACCAGACGAACGAAGGTGGATAGGCATGCATTCTGCTTTCAATGGCCAAAGTGTGTCAGACGGCTTATCTTTT
AGTTTTGATCCTCGTGGACTGGCAACGACTAGATACTTGTGTTCTACCAACGACGTTAGTCCATCAACCTCTTGGAGTGTCACTCTCCAAGACTCTTTTA
TTGGAAGCGGTGATGACAATCTCTGGGTAACTTCTTGGAGCGGTGCAGACAAGTGGTACCAGCTTTGTCAAGGAATCGTAATTCTTGGAGGTAGATCATT
CTCACGGGTCGGATCCTTTGTAAGGAAAACATTGAGCCCCATCAACAAGAGCGACAAACCATTTAACGCGCGCGTCAAATTCACATACTATTTTGTGTTT
GAACCACTTTACTGGGTAGCACTTCTTCTCAAGAGCTCTGAACCGAGGACTATTCGGGTTTACCTTGGTACCCAACTTGTTCGACAGCTGCAAGTTGATA
CCTCAGTGACCTATGCTTGCTACGGACAGAGTTCGACCTCAGCGCAACAGGCATACTTCTACCGTGGAAGGGAGCGATTTGCTGTGAGAGGATTTAGCGG
AGCAGCAAACGAACTACGTTTTGAAACGGATTTTGGTTCGTTGAACATCAGTGCCTTTGGGATTGACGAAGTTTCAATTGAGGTGGAATCATCGTTTAAG
ACACCTCTAGGACTATCGTTAGCAAATCCCGCGGTTTCATGCATGCACCTGAAGAGCGAGCGTGCTGCCAACGGTGATGTGAATCCAGATGGCCAGTACT
ATATTCAACTCGACCCAAATGTTGATCCAGTCCTTCTTCCTTGCTCTGACGGATGGATAGTTGCACAACGCCGTGTAAACGGCAAGACAACTTTCAATCG
CAATTGGAATGAGTATCGTGACGGGTTTGGTCTTGGTTCTGCCAATGAGTGGTGGATTGGAAATGATATTCTGGCTACTATCACAGCACGAGTCACCGAG
GCAATCATCGTCGTATCCAAAGATTATAAGGACACTTCCGCGTTTTATAGTGATTTTCGAGTGGCAAGCGAAAAGGAAAAATACTTATTGACTGTGCGAG
GGTACAATTCGACGGCGAGTTATGCAACGGATGCTCTTACCCCGCTTAGTAATATGTATTTCAGCACACCAGACCAGGATAATGATCTGTCCGCGAGTCA
AAATTGTGCGAGGCGAAGCCGGAGCGGATTCTGGTATGCAGACTGTCTTAGTGCAACTAGATCCGATTTAAACGCGCCATTTGACATGCTACCCATTTGC
ACATCCTACGCTGCATGGGCGCAAAGCTGGTGTCAGAAAACGGGGAGTATAGTATGGGATAACGTGGATGGTTATGACTCCTCAAAATTACTTTTACGGC
CGGACAGATGCCCACCAGGCTACACGAGTTCACAGAGTGGCGACTGTTCACAGTGTCCGGCGGGTACCTATTCAGAATCACACTCGAACGGATGTACGAT
GTGCCCTGCCGGGACGTATGGGCCGTCGGTTGGGTTGTCAGGTGT