Description :
From Genome Similarity Track
Location :
Scaffold_152:44564- 47272
Sequence
2708 bases(100 bases per row)
GTGCGCAGGGAGGGAGACCGCCATCGGATGTCCTTTGATAGGGATTGACGATGACGAACACGAACGCGTTATCAGCTATCAGTCGCGCCAACTGAAGCCA
GCCGAGAAGAATTATTCAGTCCACGACAGGGAGCTCCTGGCAATGCGATACGCTCTGATCAAATTCAGAGTGTACCTGCTCGGTGAACAGTCATTTGCGG
TTTACACTGATCACGCATCGCTGCGGACAGCGATGAAGAGCCCTCACTTGTCGCAACAGATGGCCCGTTGGCTGTCATTCTTCTCCGAGTACAACTTCGT
TGTTCACTACAAGCCGGGCAACAATAACATTCTCGCCGACGCGCTGTCTCGGCGTCCGGACTACGATCCCCGTGAGGCGCTAGGACATCAGCTCGCTGAT
GAGGACGACGACGAATGTGCGGTCTGCGTGTCGTCAGGCATCAACTTGACGTTGACCACGCCCACGCTCCCGCTGGGCGACGAGATTGCTACAGCGTACG
ATGATGACCCTATATACGGCGCCATCATGAAGCACCTGCGTGCTCCTAGTAGTGACACGCTAAGTGCCCTGTCAAAGACCACGCGGAATCAGATCGATCG
ATATCGACTGGACGGTAATCTACTCAAGTACAGCATCGACAGGTTCGATGGTCCTCGAGTCGTCGTCCCAAACGACGCTGATCTACGTGCGCGCATAATC
CACGAGTATCATGACGCCCCGACTGGAGGACATCTCGGTCGCGAGAAGACGTACGCGGCTCTGTCGAGAGACTTCTATTGGCCGCACATGTACAAGTGGG
TACGCAAGTGGGTCCGCACATGTGAAACTTGCCAGCGAGTCAAACCGTCTTCGACGTCTCAGGCCCCATTGCGCCCTCTTCCGGTCGCCACGGAAGCCTG
GCGCTCCATTTCGATGGACTTCATCTTCGGTCTTCCGCCCGATACAGCCGGGCGCACAGGTGTACTTGTGTTCGTTGATCGTTTCAGCAAGATGGTCCAT
CTCGTTCCGGTGGCGGCTTCAATCACCGCGGAAGAGTCCGCGGCCCACTTCGTCGACGTGATTTTTCGTCACCACGGCCTGCCGGAGTCTATCGTGTCCG
ACCGCGACCCGCGGTTTACATCCGCGTTCTGGTCACGCCTCTTCGAGCTCTTGGGAACCTAATTGCTGATGTCAACTGCGGCACATCCGGAGACGGATGG
ACAAACAGAACGCGTCAACCGCGTCCTTGAAAGACGTTCTCCGCAGCTATGCAAACTTCGTACACGAGCTGGAGCTCGTTCCTACCGCTAGCCGAGTTCG
CACTCAACAACGCCGAGCACTCCTCGACGGGTATGACGCCGTTCTTCGTGAACAACGCACGCCACCCACGTGTTCCGGCACTTCTCGCCGTGGGTCACCC
CACGGATGGTGGCGGCTCCACCCTTGGTGGGGGAGAACCTCCTTCGGTCGACATGGATGCCGAAGCTGCGCTCAGCTCTAGGGACAACGTGTCCGTGTCG
TGGTCATCACCGGTACGTGAACCGGTGTCTCAGCACGCACCGGTAGCCTCACCGGTGTCAACAAGCCTGCCGGCGCACTCGACTTCAGGGTTATCTTCGG
GTGTAGCCAGTGCGAACGCCCTGACTCGTTCTCCGTCCAAGCAGTCCATCGAGCCTCCTCGGCATACTGCATCTCCGATAACGAGATGGACGTCGCAGAA
CTTGATCGATCCAGGCCGCAAGATTCGTGAGCAAGAAGTTACCACGGCAAACTATACACCAAAACCCTCGGTGCTTCCTGCCGATCGCTCGGCAGTTGCG
GAATTCGTCATGCAAAGGCAATCCATCGCAAGGCTCGTCCGCGACGCACTGCAGAATGCAGTGGACAAGCAAAAGGAACAAGCTGATAAGCACGGTCGAA
AGAACGTGAATGTATTCAAGATAGGAGATCGCGTTCTCCTATCGACCGAGGGAATCCGCGCTTCCGCCGTGACCAACCTCGGCGCCAACAAAGTTGCCCC
ACGCTTCATCGGTCCTTTTCGTGTAACCAAGGCTGTGGGCGACGCCTACACCTTGGACATCCCGTCGTCACTTAGACTCCACCCGACGTTTTACGTCGGG
CGACTCAAGCGGTACTTCCCTGCGACGATTCCTGATTCGATCCAGCAGACGGAGCATGCGTCGGGCGACCAGCCCGACGAGCCTGACGCGCCAGAAAGCC
GTCAGCCCCTGGCGCCCGCTCTCGCGGACGATCTCCCTGCTGGGCAGAGCCAAGCACATGCGTCTTTAATCCCCGTAGGCGAGATAACAGCTCCCGGTTC
GACTGACGAAGCTCCGACGCGATCTGCTCAGCCCGCCAGGCACGATCTTCCGCCCGCTCAGCCCCAACCTGAGCGTCCAACGCGCGGTTCGAAGCTGCCT
CAACCTCGCCCTGAACGTACAGGGCGTACGCCGTATCATCGTGAAGGCCCACCACCGATAATTGACTCGGTGGGTGACGCGCGCTGGATTGTGGAGCGTA
TCGTTGACCATGAAGATCCCCACAGCTCGACCGCTCAACGAAACGTCCGTAGTCGTGCTCCTCGCGCGGTTCCGACCGCGCGCCGCTACTTGGTACGTTG
GCTCGGTTATTCCCCAGAACATGATACGTGGGAGTCCCGCGCCAACCTTCTCCGCGACGTTCCGGACGTGGTCCACGAGTATGAGACCATGCTACTTGAG
AAGAAGAA