Description :
From Genome Similarity Track
Location :
contig_120:44560- 46085
Sequence
1525 bases(100 bases per row)
TTAGAGATGGTGTAAGCGGATCGGCTCAGTACTGTAGCTATTTTGCTTCAGCGTTCGGTTATGTCGGGGTATCGAAACGACGAGGCTTATTGAGAGGGAC
CTCTGTGCTGTACGTCCACCTGCGAGCGTACGCCGTTGGCCCCTTCTTGGTACCAGTGTTCAGCGAGGCCTTTTCTGCCTGTTAATCCATGCCGCTGTCG
GAGGTTTCAACGCTCGCTACTGTGGAGCTGCTGGACAGCTCTCTAGTAACACCGATGGGGTCCGCGCATCGGCCAGACCAAGAAACTGGCGACTGAGTGA
GTGCTGCTGAGTGAGTGCTGCTGAGTGAGTGATGCCTCCACGAGCGCATTGCGGCTTTTGGAAGTTGCTGTAGGCTACATATCCTTTTTCTATCTATACG
GTTCGCATCAAGTACGATTGTGAGTGATAGTTTCTCTTCAAAGAGAGTCGCCCGCCTGTGCGCCGTCATCACCTTGAAGCGGAAAGGAGGGGAGGTGATT
GGCGTAGCGCGCGGCGATGCCAGCAATGTCATTGCGCACTTACAGCGAAGGCAGCCCGGCGAGGTCGCCGGAGCGGTGGCTTGTACGGGTACTGGCACAT
GTATGTACAGCACGCATCGACACGAAACGCGGCAACCCACCGTCTACGGGGACGGATTGGAGGGCGGAATCTGTATATCGCTTGAGCCAGTACATGGACC
GGTAACAGTCAGCCTGCCTTAATCCTACCAAAAAGTAAAGATACATGTAGATATCCGCCAAACTCTTGGCGGTATAGTTATTGCTTGCATAAGGTGGCTT
GCTGTCGTTTATGGTAATGGTGAGTTCGATCTAATATGTACATGTTATCAAGATACTTCACTGTACTGTACTTCATATAAATTAATTTTCCGGTGCAATT
GTTTTCAATCTTCTTCAGTTTTCTTTTTTGGCGACTAAAATCGCTTTTCTTGTTCGATGTCGATGCTCGCTGTGCGAGTGCATGCCGACATATTCACTTT
TCGCTGTGGATGCGATTACTAATATGTATTGAATCCAGTCCAGACGACGTTGCCATTATTTTAATACCTACGTGTACAGCATGGAGAGACGCCCCATACT
GCAGCGCTAGCAAGGCCACTTGGGCCAGTGACTTGTCTGTCGTGTGCAAAAAGCTTGATCTCCACGAAGAAAACGAATCCCCGCTGTAGGAATAGTCGAA
AGAACACCGACTATGAAGGTCTCAGACAGCGTGTCATCGCAAGCCACCGCTCCGGCGACCTCGCCGGGCTGCCTTCGCTGTAAGTGCGCAATGACATTGC
TGGCATCGCCGCGCGCTACGCCAATCACCTCCCCTCCTTTCCGCTTCAAGGTGATGACGGCGCACAGGCGGGCGACTCTCTTTGAAGAGAAACTATCACT
CACAATCGTACTTGATGCGAACCGTATAGATAGAAAAGGATATGTAGCCTACAGCAACTTCCAAAAGCCGCAATGCGCTCGTGGAGGCATCACTCACTCA
GCAGCACTCACTCAGCAGCACTCAC