Description :
From Genome Similarity Track
Location :
scaffold_120:44550- 46079
Sequence
1529 bases(100 bases per row)
ATCGGTCTCACGTCAACATGCCGGAAATACAATGTACAGAGGTCCCTCTCAATAAGCGCATGGACTCCGTGGCGGAGGTTGGTGAGGCGATTTCAGAGGG
ATTAGAGATGGTGTAAGCGGATCGGCTCAGTACTGTAGCTATTTTGCTTCAGCGTTCGGTTATGTCGGGGTATCGAAACGACGAGGCTTATTGAGAGGGA
CCTCTGTGCTGTACGTCCACCTGCGAGCGTACGCCGTTGGCCCCTTCTTGGTACCAGTGTTCAGCGAGGCCTTTTCTGCCTGTTAATCCATGCCGCTGTC
GGAGGTTTCAACGCTCGCTACTGTGGAGCTGCTGGACAGCTCTCTAGTAACACCGATGGGGTCCGCGCATCGGCCAGACCAAGAAACTGGCGACTGAGTG
AGTGCTGCTGAGTGAGTGCTGCTGAGTGAGTGATGCCTCCACGAGCGCATTGCGGCTTTTGGAAGTTGCTGTAGGCTACATATCCTTTTCTATCTATACG
GTTCGCATCAAGTACGATTGTGAGTGATAGTTTCTCTTCAAAGAGAGTCGCCCGCCTGTGCGCCGTCATCACCTTGAAGCGGAAAGGAGGGGAGGTGATT
GGCGTAGCGCGCGGCGATGCCAGCACTGTCATTGCGCACTTGCAGCGAAGGCAGCTCGGCGAGGTCGACGGAGCGGTGGCTTGTACGGGTACCGGCACAT
GTATGTACAGCACGCATCGACACGAAACGCGGCAACCCACCGTCTACGGGGACGGATTGGAGGGCGGAATCTGTATATCGCTTGAGCCAGTACATGGACC
GGTAACAGTCAGCCTGCCTTAATCCTACCAAAAGTAAAGATACATGTAGATATCCGCCAAACTCTTGGCGGTATAGTTATTGCTTGCATAAGGTGGCTTG
CTGTCGTTTATGGTAATGGTGAGTTCGATCTAATATGTACATGTTATCAAGATACTTCACTGTACTGTACTTCATATAAATTAATTTTCCGGTGCAATTG
TTTTCAATCTTCTTCAGTTTTCTTTTTTGGCGACTAAAATCGCTTTTCTTGTTCGATGTCGACGCTCGCTGTGCGAGTGCATGCCGACATATTCACTTTT
CGCTGTGGATGCGATTACTAATATGTATTGAATCCAGTCCAGACGACGTTGCCATTATTTTAATACCTACGTGTATAGTATGGAGAGACGTCCCATACTG
CAGCGCTAGTAAGGCCACTTGGGCCAGTGACTTGTCTGTCGTGTGCAAAAAGCTTGATCTCCACGAAGGAAACGAATCCCCGCTGTAGGAATAGTCGAGA
GAACACCGACTATGAAGGTCTCAGACAGCGTGTCATCGCAAGCCACCGCTCCGTCGACCTCGCCGAGCTGCCTTCGCTGCAAGTGCGCAATGACAGTGCT
GGCATCGCCGCGCGCTACGCCAATCACCTCCCCTCCTTTCCGCTTCAAGGTGATGACGGCGCACAGGCGGGCGACTCTCTTTGAAGAGAAACTATCACTC
ACAATCGTACTTGATGCGAACCGTATAGA