Description :
From Genome Similarity Track
Location :
Scaffold_584:4455- 5585
Sequence
1130 bases(100 bases per row)
CAACATGGTGCAGAAGATGTGGAGCACTCGGAGCAATGCGACAATTTCCTTCTCGGCCGGATGGTATCTGAGATCTTGATCATGGAGCACACTCTTCCGT
ATACTGAACTGGGAGGATGATTCCTTCGTATTCTTGGCTCAACACAGCGCGGACAACCCAGGGATTCGCGTGAACGATAATCACGAACGGCTTTTCCCTA
TTGCGGTGTCTGAGCAGTGGGATAGACACGATCTTATGCTTCAAAATCTCAAACGCTGCCTTGGCTCGGCTGAGATCTCGGCCAGCTCGAATCTGCTCAT
CGATCAGCTCGTAGAGGACAGAGGCCACAACCGGGAGGTCTTAAATGAACTTGTTGTAACAGTTCAGACTCCCCAAAAATGACTGAACCCCTTTTAGCGT
CGACGGGAACGGGAGTTCTCGTACCCCTTTTGCGATGTTGGGCTTGTCTGTGATTCATTCAATCCCAGTTTCATGAGACAGGTAGAAAATCGTCTTCTTA
CCAAATTCACTCTTGGGCAAACTCACCGAAATCCCCCAGTATCTCAACCAATACAACAGCCGATCCAAATCGATGCACATCTGTTCGCAGGTCTCAGCTC
TATACGCAATATCATCAATATACCAACTTCGCCCTAGAACTGGGTTCAGCACAGGTGGAGCCGGGATTTTCCTTCGGAATACTGTCATTTTCTCTGATGG
TTCACGCATGTCACTTTCCGTATCTGAGGGGTCAACCGTGATCCCCAGAAACTCCAAACGTCAGCATTCACTTGTGCTTCCTTGCTGGACGGGAGACGCA
CAAAGCCCCAGAGGCAGTTTTCCAGCATCTGCTGATAGATGAGTGGCGCGTTATTCAACCCAAATGATATTCGCTTCCACTGGAAGTGACCTAACGGGCA
AATAAACGCTGATATATATTGGTTCGGACAGTCATTGGCACGGCCCAGAATCCACTTGTCATGTCCAAGCTGAGAAACCACATCGCATTCTCAAACCCAA
TCAACAGATCGTCGATCAAAGGCAATGGGTAATGCATGAGCTTGATCAGCTGGTTCACCAACCGGTAGTCAATACAAAGCCGAATGTCGACTcggttctt
cttcatcacaATGACGATCGGTGACGCCCA