Description :
From Genome Similarity Track
Location :
Scaffold_4:445419- 446989
Transcript NameFunction/comments
Physo_502415Hypothetical protein
Physo_503780phosphatidylinositol kinase (PIK-F)

Sequence
1570 bases(100 bases per row)
ACGAGTGGTTGCAAGTTTTTGCCGCACACGATCTACCAGCGCCCAACGACGACATTGCAGAGGACCGCAAAGACCCACCAGAGCAACCGCGACACGGGTA
GCTCTCGTGCTGCACCGCTTGAATCAAGCGCAAGCACGACTCAGGGAAGCTGGAAGGAGCGGGGGAATGATTCTCGTTTTTTAGTCCCGGACGGGGATTT
TGTCTGCTAATCTGTCGCGGCTGTGGCATTCGGCATGCTGCCTCCGCTTCTGCTCCTCTAATTGCCGTCTCTTCGCCGCCTCAACCTTCTCGTCAAGCAA
GCGGCCCAAGATGCTCAGGAAGAGATTCTCGTCTTGCACGTCATCATCCAGTGCATCATTCAGGACTTCAAACTCGTCCTTGCCGTCTTCGGCTCCGATG
AAGGAGGATGTAGGAGATCGAGCACCGTTGTGCTCCATCGAAGCCTTGTGGCCATTGGAGGGCGCACTCACGGGAGTAGCGATCGACCCGGTGTATCCAT
TCTCTACGTGTTGGACAGAATCCGATAGAGCGCTTGATGCCATATCGTCCCAATTCAGTGAGAAGCGCGGCTTGTCGCCCCCATTTAGCTCTGAATGTCT
CCCCATGCCATTCGAAGTGGGGAACTTCGGACAATCTTCATCTTCTTCATCTGAGCTGAACGGAGCGTAACTTGCCCAGAATCCAGGCGGAGATCGTGCA
CCACTTCCAACAGGAGAGCGCCCGAATGCAGAAGATTCCTGAAGTGAAGGAGGGCCGATTGACACGCGCAAATTTCGGAATGCCGCTCGAGGAGACGATG
GTATTGCGATCGGTGCAGTGCCTTGTCCTTCTTCTGCTGCAATGGACTCGTTCGCCTTGATGACTGGTGTGATCGTTGGCTGCAAATGGGCGTGCTGGAA
GAGAGCGTCATTTTGCTTGCGCTGCTTCACAACCTGCAGCTGATGGAAAGCCTCGATGCACAGCTGCTCTAAGATGGAGGGCGTGTCCAGATCTTCACGA
CACATGATCCGAGCAATCTCGTAGAGTACCAGGTCGGCGCGTACACCCTTCTGCAGCACCATGCTCGCGATAATCATGTTTCGCCGACATGCGCGTCGCA
AAGGAATTCTTCTCGCCAACCGATCCGCGTCTTCCTGGGCAGATAGTGACAGCACATAAGCCCGGTCCTCTGCGCTCAGTGGCTTCTGAAGCTGCGGCCA
ATTGTACCAGCACCAGTCGCACCAAGCAATCTCCAGGAACTGCGGTAAGCAGTAACCATGGTCAATCGGTATTAACTCGTACTCTGCGTGCCCTGTAGTC
GGCGACCGCCGTTTGCGTACGAGAATATTGGCGTCGTTGCGGTCTGTGTTCAAGAGCCGCATGTCCAGAAGCACAATCTTGTGCACTTGGTGGGTCGAGA
ACTGGTTAGGAGCCAAGTCGCTCACCACGTCATCGTGTCGGACAAACTCCTGCAGTGATCCAACCTTGAAATGCAACGCGCCCGCACTACCAGCATAGTT
AAACACAGGATGTCGCGACTCCACGAGAGACGTAGCTGGAACTCCCGCAAAGTGGTCCTGTGGGTGACAA