Description :
From Genome Similarity Track
Location :
Scaffold_254:4454- 8767
Transcript NameFunction/comments
Phyag_g3986hypothetical protein

Sequence
4313 bases(100 bases per row)
CCAACCCACGACGGCACCTCTTGTGCTAGTTCCACCTGCTATCGAACTCAAGCTACAATTCCTGGTTGTGAGGATTTTACGTGCTGAGCATCTTCCTCCC
ATGGACACTGGAATGTTAATTGGTACACCGGGTATCGATGCATACGTTCAAGTGGTGTTTGCTGCGAACGTACCTGGTAAATCCTCGGTTGTGACCGTAA
GAGGCCGGGGAAATCTTGCTCCCGATTTCTACGAGGAATTGTGGCTACCAGTACGCATTCCTACGTTTTCTAGACACATCGGACTGTCGGTTTGGGATCG
TGATAGGACATCTCCAGACGAACTGGTGGGTGTGGCTTCCCACGATTTCCTTCAGGTTCCACCTGCACCTCTTGTGGAGGATACAGCTACTAAAAAGGCA
CAGGGGAGTCCACAAAAAGTGAATTTGATGCTGGAAGATACATATGAAGAGGAATTCGAAGGAGAGTTGAGCCCCACTGCTATGCGAGAGAAGCTAGAGC
TGGaggaacaacagcaactaGTCGTTGATGCAGCGCCGCGTTGGTACAATTTGTATGGACCTCCTTTGCATGGTACAAACCCAAAGCGTCAAAAACTTGT
TTCACGTCACTCTGAGCTCGGTTCGACGTATCGTGGGCGGGTATTGGTGTCAATGGTTCGTGTCGAAACaccgcgagaagaagatggtgaaAAGATGAAG
ATTAAGCCAATGACTGCTCCAGAACGTGAACGTTTTGAGCGCAGTTCCCCAAAGACCGTGAAATATATGCTGCGAGGAGCATTGTACTGCGGTGTGGAGT
TACCAAAAAGCTCAGGCTCCGCTTTGACAGGAAGTTCAGCGCACGTTCGTGTAACAATTTCGCTTGGCCCATACTCGATAACTTTTGAGAGTCAAGAAGT
TGCGAAAGATGGATCGGCTACATTTGAACAATGCAAGGACCACCGCTCTGCGATGGATCTACCCGCCGATTTGACCCAAATTCCAGACATTATCGTCACG
CTTAGTCGATatgttggtggcgttgtttcagcagcaactcacaAAGAGGAATGTGTAAGTGTAAGTTTTGCCCGATTTCGAGCGGAAGATTTATTTTCTC
GCGGATTCACAGCAAAATGCCACTGGGTTGTGCTACGAGAAGAAATAGCTCGTCGCCAAACACGGTATGTGCTGGAGCAATCTCAAAATCCTggggttct
gctgcttcgtttAGGTTTTGGTCGAgtggagatggctacacgtCACCCGTGGATCAACGAAGGAGATAGCACTGAACTGTTTGCTCCATTTCGTTTCCCA
CGAGTGCATCGAGAAGTTCGCGTACATATTTTCCAGGGTCGAGGATTGGAATCGCCTTCAGGAGCGGCACGGGTGCCTACTCCTGTAGTTGAAGCTCGTT
GTTGTGGACAGCATAAGCGCACAGCGGCGCGTCAAAGCACCTCGGCACCACTTTTCTACGAGTCACTGGTCTTTCTCACGAATGTTCCTGCGTCAGACGT
GGTGTATACTCCCGACATTGCGCTACAAGTGCAAGATGCCAGTGCGAATGGAGGTGCAACTAGTGCTCTAGGACAGTTAAGGTTACCTCTAGCGTCAGCT
GTGCGGTCTTCAGCTACTGCAGGGTCTCCAAAACCGCAATGGTATGAATTGAAGCGACCACGGAGTagatcttcttcgtcaacaAGTTTACTACTCGCAG
AGTTAGCTGGTGGTATTGGATCCGCAGGTCAATTGTTGATCGCGATCCAGTATATTGACCACACTGGACCAGCCccaccagctcttcttcgccaaccaGA
CCCAGTCACACCTAAATATACAGATGCGAATATCGATATTGTGGCACTTGGAGTGCGGCATCTCAAGGCGCTCAACACGTTAGGAGTTCGACGTCCCCAC
GTGGAATTTGAACTGGTGGGAGGGTATTTTGTGGATGGATCAAGTGTCAAGCGCACTCAATCCGTGTTGGGATcttcaagcagcaagaaTGCGAACTTCT
TGGATCGAATCGTGGCTCGTGTGAAGCTGCCAGTGGACACTTTGTACGCACCACAACTGCAAATTCGAGTATGCGATACAATTCTCGGTGGACTACGAAA
GACGATATTGGCGTCCTGTATTGTAGATCTAACGAACAAACTTCCGTGGAGTCCGACGTATCGTGTTGACATTGCTGAAGGATCTGGTTCTCCATTCCGA
AGTCCTTCAAAAGGGAAAACACTTAACCCGAAAAAGTTTACGAAAGACACTAAAGAAGATAACGGCAACCcggaagaagatgaggatgTACTGGACTACT
TAATGGCTATGGGTCAGTCTGAAGCAGAGACAGATTTTCCGACGGATGACGGAGTTGGTATTGGAGAGCTCCGTCTTCCGTCCGTCTTGCAGTCTCACGC
TCGAatcagcagcatcaaaaCTATGGACGACACAGATCCAGCGCTGGTAGAACAACGACGTCGAGAAGAGGTACGTCGATACAACGCTGGGAAATCAGCA
CTGCTTCTCTCACATCAGCGTACGAATGACAAACGAGGGTCTGTGCTGGGTTCTCCGAAGAGTAGCAGTCGTGACCAAGAGCACCAACGCGCACCTTACC
TTCGAGGAAGAGACTGGTGGATTTCACAGTATGGaggtgaagagcttgagaaCTATTTTTCAAGCCCAGCACTTGAAAGTTACACGCTCAAACGACCAGT
ACTTTCACGTCCGTCAATGTTAAGTTTTGAGCGTGTGAGAGTgcagcttcgtgctggaaTATTCAAAGGACGAATTACAGTGACTGAACGAAAAGGCAAG
TACGAATTCCGATCaaaagaggaggaaggagcaAAACATGAATATTTGGAGATGCAACGACTGCAAGACGGACCTCAAGCTGTAATCGTGCGGGTCTATG
TTCTACGCGGACAAAACTTGATGGCAAAGAACTCGAACGGGTTCTCCGACCCGTATCTGAGAGTAAAACTTGGAAGTTCTCGTGTCAACGACCGCTCTAA
CGCTTGCTCTAATACCCTGCAGCCTGAATTTTTTCGCATGTTCGAGTTGGAGACCACGCTACCCGGTGCTTCGCAGCTGAATATCGGCGTTTGGGATCGT
GGTTTCATTTCGGATCAACTGATTGGGTCGACAACGATTGATCTGGAAGAGCGTTGGTTCCATCGCGAGTGGCAGGAAATCGGGGAAAATGGAACATCGG
GAAAAAGTGAAGGCAAGCTTAAACCGGTCGAGTATCGACATCTGTACGTACCACAAAACCGTACAACATCACAGGGCTACTTGCAGCTTTGGGTGGATAT
CCTCACAACACAGGAAGCAGCACTTATTGAACCTGTCATCATTTCCCCGCCAGAACCGAAGAATTTCGAGGTTCGTGTAGTTGTTTGGCGTGCTGAAAAC
GTTCAGGATCAAGTACAAAGTGAGATAAACGACTATTTCGTGAAGGCCTGGATAGAAGGTGGCCGATCTGAAAGTACCGACACgcattggcgctgctcgA
ACGGAACTCCGTGCTGGAACTGGCGACTGATAATGAAAACGGAGTTCCCACCACGGTCGCCCGAGCTGGCACGACTTCATATTCAGCTCTGGGATAAGGA
CGTCCTCAAATGGAATGACGTGcttggagaagctcaactGGATTTGTACAAATGGCTGCGTCGAGCGTACGAGACCAACCGCTCTGTCGCTCCATTTCTC
GAACTTAAACGCCTCGCTTTGCAGACACCGGTACCTGGTGGCTATTTCAATGACCAAAAGGAGGGTAACGACGATACTGACGAAGGTTCTAGTGACAATC
TCAACAacagtgaagatgaagaagaagacgaggacgaaaAATACGCTGTGAAACTGGCACCTCGTGAAGATAATGCGCTCTTGGGtgagaagacgaagaa
gaaaccatCGCGAAAGCAACAGCGGCAAACCAAGAACCCTCAGGAACAATCGCCAGCTCAGCGCAAATTGGCCAAGGCTCAGAAAGATGATGCCGACGCG
GCGGCTGCGCTCAACAGCCTACTCGATTTTGTGGGGCTCGGCAGACTACCGGACGATGCAGAGTGGATTCCGATCTACTTTACGGAccgtgaagcagcag
taTCAATGGAAATGGGACGGATTGGTATCTCGATTTTGATAGTTCCAGAGGATGAAGCACTGGCATCTCCAGTCGGAAAAGGTCAAAACGCACCCAATTT
GAACCCGTACTTGCCTCCTCCAGTCGGGCGCATGCAGTTCAAAGCCAACCCAATTGCAATGATCAAAGTGTTAGTCGGCCCTAAAATGTGCCTTCGTCTT
TCGAtcatgtgct