Description :
From Genome Similarity Track
Location :
scaffold_23:445365- 450348
Transcript NameFunction/comments
Plaha_PHALS_15126hypothetical protein
Plaha_PHALS_05926tkl protein kinase
Plaha_PHALS_05927hypothetical protein

Sequence
4983 bases(100 bases per row)
ACCACCTTGTTCTCCTCTTCAAAGTCTCGCGTATGGTAAAATGTGCACGCGGTTGGTTCATGCGCTTGTTTACTTGTGTATTATAGCGATCTCTGCCAGT
TCTTCAGGCTCTAACAACTCACCTGCAAGTGGCATTCTTAATACGCTGACCACGAGCTGCAATGGTGGCTGCAGAAGCAATGGCGCCTGTGTAATCGTGG
GCCAATCCGGATACAATTTCGTCAACTGCGTAAACGACATTAACTGCATCACGTTGTCGTCTGGTCAATCTGCGCTTTGCCTCAATGCTTTCAGTTCGAT
GAAAACTGAGTGGGTCTTTCAGCCCGGTGAGAGCAATGACACAGCAGGAGTCGGACCCTTTGAACGTGTTGGATTGCTGCAGCTCGACGGCAATGTGACA
GAGTTAACATTCAAGAAGgcagaagaagaacaaaGACCGCTCTTTGGATCTCTAGAACTCGCTTCTATGAACATACAACCAGATGCTACACTGGATAAAG
TGGcgtttcaaaatttgagtCTGTCTGGACTAGACGACGTAATGCCTCTAAACAGGGTTAAACGAATGTAAGCGGCTCTTAAGCAAGTGAGACGAAATGA
GGATTAACATGACCACTTGGCGTGTAATAGATATTTTAACAACTGCTCACTACGTGCAATTCCTGCAGTCGCTGTAGCTGGTGATTCTGTCACGGTCATG
TAAGATATCGCTTTGGCGCAAGTATTTGCGATTTGATGTGTCTCACTGAATTTGTTGTTCTACTGTTCTAGTGATCTAGCTGGCAATGCCATCAACACTG
TGGACACAAAGTTTCAAAATCGGAATTCAACTAATCTTACTATGCTGTGCGTTAACACTGCGCACTTATTTTCTTGCTGTGGCTAAAATCAAATTCATTT
CGTTTCGTAGTGATTTATCCTCCAACGCGCTTACAAACTTTAATCTTGTCGCGAATAACTTTCCAGCCCTTACGAGTTTGTAAGTTTTTTTGTGCTGTAT
GCTTGGTCATGCCCCTTACTTAGCTAAGAGTATTCAGATATCTGCACGGTAACTTATTACAGGCAATTCCCAATGTGATTTTTGGTCTATCGACACTCCA
GGAATTAACACTAAGTGACAATCCCATAAACGCATCGGGTCTTACAACGCAGCAACTGACATTTCTATCAAATTTGCGCAATTTCACGATCGACGGTTTG
ACCAACACAAGTGAATGTCCAACAGCTGCAGTGCAACATGCGTTGAAGactttttttgtattttgcGTGGGGGTTGCTGAGGCTGTTCCATTCAACAACA
GTATACTCACCGAACAGCCACTGACAAGTGCGCCTGTGGTGACCGAGAGTAAAgcatcatcttcttcatcacacAATACTTGGATTATACTTGGTGCGTG
TCTTGGGGCTCTATTGCTTCTGTTCCTTTTGGGTATCATCTGGTGGTGCTATCGCCGTCGAAGGGATGAACAGCCGAAGCTTATGAATAGTATGACACCA
ACGATTGGTATTGGAATGGGCGACTTGTCTGAACATCCATACATGGGACTAGGAGCTCCCTTTTCCAATGTTTCGAGTCAAACATCGGCAGACTTCGAGT
TGCTTGCCTCTGTGGCAGACGGCTATATTGGACTTACTCGACTTTCTTACGACGATGTATTTCTCCACAAGATGCTGCGGGTAAGTAGCCGTAGTGAGTT
GTGGCTAGGCGAATACAAGCAAAGAAGTGTGATCGTtaaaaagatcaaaagtAACACCGCATCAAAAGCATTACTCCGGGCCTTTGTGACTGAAATTGAG
CTGATGTTTGAGCTCAAACACCCTAATATCGCGGTTTTCAGAGGCGCTATGTGGGATGCAGATGGTACAGAGCTCTGCGCAGTGGTTGAGTTTGCCGAAA
ATGGTGCTTTGCGAGACTGCACTGTGCATAATGAGATCAATTTTTCCGTTTCGAAAAAGTACGATATTGCCCGGCAGGCCTCAGCAGCAGTGGCGTTCTT
GCACAAACAAAATATCGTTCATGGTCGCTTGAGTGCGTTTAATATTCTGTTGGACAAGAACTATTCTGTTAAGTTGAGTCTCTTCAGCATCTTTCACTAT
GTGAAGCTTTCACCTCTAGACAACGAGTGCAGGATTTTCGTGGCTCCGGAAATTTTGCGAGGCGAGCAGCCGTCAGAAAGGTCAGATGTTTATTCCTTTG
GTATAGCTCTTGTAGAAATCGACACCGGGGAAACTCCAGTGATGGACGCTCGAAGGCTGTTGATGGATCGATCGAATTGCGATGTCAACGTGTCCTACAC
AGCAATGAAGATAGGGTACCGCTTGAGTAATCTTTGTTCTGAAGTGATGAAGAAAGTCATCATTGCTTGCCTGGAGAAAGACCCTGTACGACGGCCGTCG
ATGGATGAGGTGGTATTGACTTTAAAAAATGCAGCGATAAAGCTGTAAGCTACCGCTCGACACATCGTCGTTCCCAATGTATCGTGGATATCTGATCATG
CAAAAAGACTTTGCCGACAACGCAGCATCAAAAGAACGCAAACTCGCATGATATCCTACAAGCTACCACTGAGCAATAAATTATTTTTGGATCGATTCTT
CCGGGATTGAAATTTACATACCAAGTGCTTCAGCTTATGTATATACCACGTGCCTCCCACTCTTTGATCATGGAACTATGCTTCATGAGCCTTTAGTACA
TTTCAAGTAATGTAGCACGACTGATTCATACATGTGCACATCGCAAAGGATAGACGGGAAACTGTGCAGAATAAGCGGACGATTGAAAGTAGTTAAGGGT
GAAAACGGCAAGCTTGATGTTGCCCAGCACATGAAATTTTTCATTTCTATGTAAACCCTTGCAATTTATCCCGTGGCTGATTTTCGCCTTGAGAGAATCG
TAGTTGCGATAAGAAAATTGTGTGTTTCTCAGCGGTAAAATTTAGTTTCTGCAACGGCTTACAAAGATTGTGCTCTTTAAAATTTATCTGTTTACTGTTG
TCTCATGCTGCGAATATGCATCCATACCGTTCATGTTAGCATTGCTAATACATAAGTTCTCTTTCGCTGCTTGTTCGAAGTGCCGCATCTGTAATGGTGC
ATGTTTTGTTTCTTTTGTGTTCGTCACGTGATTGTTTGACAAAAAACGACGCATTTGAAGTGAGTTACCCACCAAAATTTCAGCTGTTCAAGAGACAACC
CGATAAAAAATTAAGATTGCCTTTTTTTAGCTCGACGTGCGTCAAAGTATCATAACAATAAATATACTCGCGCCATTCTACTGTTCAAATTTTTTTCTAC
AGTGGGTCCAAAGTGCGCGCGAAGCCTCCGAACATTTCTTGTGATTTTCTGCACATACTTTGATAAAGTGcgagaaaaaaaattatcgtGGCGCAGTGAT
GTGTGATGCATCGGCGCTTGAGGCTTGGTGTAGAGAGCATACGTTACCGTTGCGTTCGTAAGCTGGCTTGCGACACCCTTCTACTACACATCGTTTGCCT
AATTCAAAATACAAGTGGCAGTCGATGAATGTGGACAATACGGAAATTTGAAGTAAGATGTGGCTAGCTCAAGAATGCCAAGATTTCTTGCAGTATTGTA
TACAGCTTACCTCCTCCATGAGCCCAGCAAAGACCGTGAGATACTGCCGTCTTGGTACAGCTGGCCTCGCTGCATTTGCGGCCTTAGTTTAAAATAAACG
tagaatttaatttttttgatgaagTCCATTGTAATGTTAGAAAAAATAGTCTTACCTCCACCGTGAGACCAGCAGACGCCGCGAGACTTAGCACGATTTT
CGCACTCAACTACTGTGCACTTGGTTGAGCCACCTGCAAACATTTCGCACCATTGTCAGAGCAAATCATGAATCCACCATTTTCCGCAATTGTCAACGTT
ACCGTGTTTCCAGCACACACCCAAATTTTTAGCACTACTCGTGCACCCCACAACAGCGCATCGCTTCCCACCCTGTTTTATGCAGATTATTTGATATGCA
TCATTTTTCGTGGTGAGAACAGAGCAGATAAATTAAAGCAATCAACTTCAACGTACACCGTGACCAATACAAAGTCCACGATTTACCACGTAGCGCGTAC
AATTTTCAAACTTACAAATGCGAGACTTCTTTACTGTCACTTTCATTCCCTTTGGAAGTGACACATCAACTGCCAAGTTCTCCGTCACCGAAACACTTGA
AGCAACCATAAGATTAGCTGCAACACGAATCAGCAAGTCGCGAATCAGCCCGCGCCAATTGTAAAGGAATTGATGGATACATGCAATTTGAAGCGGTTGT
CTATGACGTTGTTGTACCGTAACTTACCAAAGCTAGCACCAGCAGAATGGGTCTGATCCTCATCTACATTACCGCCAAGGATAAAGGCAAGTGAGCTTTT
ACTGGCCACTGCCACAGCTGTCGCAGCATCGTCCGAATTCATAATGCCCGCCGATCGGTGCCGGTTAGCGGCCAATTGTAGTGCGGGAACAGATGCTGCC
GGGGAATCCTGATGGGCTACTCGCTCTAGCCACGAAGTACTCATGTTAATGTCGTCGGAATTAGCTGACTTCTTCATGCAGGAGGATGAGGGCTTGGGAG
AGGCAAAAAGTAGCATTCACAGCTGAGATAGGGAGGGCGAGAAGAGTGGAGAGGACACGCAGAGATACTCGGCTGCGAGTGAAAAGATTAATTACTAAGC
GGCTTGTAGCAATCTACACAGCACTGTTAATGGTCCCAGAACCAGTGCTCAAGTCGCCTCTGTATACTTTCACAGAGAAAAGGCGCATTTGACTGCCCAG
CAATTTACCAGCTGAACTACTGATGTCCACTGAtccgctgtttgtggatgcaTACACTCTTAGATTTTGAAAGGGGACTAACGTATGTCATTAAGAAACT
TGCTAATTTGGCCAAGGCTTGTTTCTGTTGTGCCCCTAACGAATAACCAGTAGCGCTCCGTATGGCTGACATGCTTGTCATCT