Description :
From Genome Similarity Track
Location :
Scaffold_1264:4451- 5851
Transcript NameFunction/comments
Phyag_g10097hypothetical protein PHYSODRAFT_508758
Phyag_g10098protein phosphatase 2C, putative

Sequence
1400 bases(100 bases per row)
CGAGCGATGCACAGATCCGCAAGCAGATGCCGCCTGGATGGAAGCCCGGCGACCCGGTGGATCTCCCGCTCGACGCGTTGCTGCACTACATGGGTCGCAG
TTTCTTCACGGAGCACGGCATCACATTGCCCGAGTCTTGGAAGACGGGAGATCCGCTGCCTCCCGACGCGATGGAGATCCTAcgcaagaagttcaagctg
CCGGAGAAGCGTGCAGCACTGTACGACGATGAagtcgtggacgacgtcgagagtttgcgcaagaagcgcaaactcGAAGAGGGCGAAAAAGCCGACGAAG
AGAGCGACAGCTCGAGCGACTcaagcgacagcgatgaagaagcccCCAACACCATTTCACTCAGcctctcgtcctcctcggaAGATGAAAGTGACAGCGA
CTAAAAACCGTGACGTGCATGGCGcacacatggctacatgtagccatgcaCTGCTTATCGTACACCAAACGACGCGTATCTTCTCATCCTCGGATACCTC
CAGCTTATCTTCGCGTGTGCACAGGTGTCGAGAGCCTTTTCTTAGCCTCCTTTATCTCGTGCAACGGCCTGGTGCTCCTGATCTCTTCGCCTATAATTAC
TGTGCCACAGATAAACTCTCcccatctcctccatccgTTGGCCTTTTGCAGCTAAGTCGCGGTGCTTGATCACTCTGGTATTTGCagcgtcgcagtcgca
gctcttctcttcttgttACCTCTCTCCACAGCCTTCACCATGGCCTCTCGACCGATTCAGAAGATGGGTTCGACGCTGAAGCTTCGTCAACAGgaggcca
cggccaccaacGTGGCGTCACCTAAGGGTATCTCCATCAAGACACCGGGCAAGCTCCCGGTCGCTCAGACAGGAGTGGGTGACCACTCGCTCggtcttca
acgtcgtcggCTGTCGGTGGTGAGTGACAACAAACTGGTGGAAGGGATGGCAGCCgcctccatcgacgacgtggacagcagTGAGCAAGCCTCAGCCGAT
GGCACCTGTGCCGTCGTATCCTTTGCCGGACTCTCCAAGAAAGGGTACGCACCGTACAACCctcgcaagaagaaccaaGATGCCATGGTGATCAAGTACG
AGCAGAacacgcagtcgctgctgctctgtgtATTCGACGGACACGGTGAAGCCGGTGACGGCGTGTCGGGCGCCATTCGTGACAAGTACGCGATTGAACT
CTTCGCCCACCCCAAGTTTGGACGCTCAGGTGACATTCTGCAGGAcgccgagacgctgcaaaCAGCCATTTCAGATGCGTTGAGGtcggtggagcagcag
gtgctgcagaacccTAGTATTGATACCGAGTTCAGCGGAACGACTGCCGTGGTGACGGTTATTCGTGATAAcctcgtggtggtgggcaACGTCGGCGACT