Description :
From Genome Similarity Track
Location :
Scaffold_71:44500- 46482
Transcript NameFunction/comments
Hyaar_Emoy2807909reverse transcriptase

Sequence
1982 bases(100 bases per row)
GCAAACGGTAAGGCAGAGCGCATGGTGCAGACACTGACTCGATCGATCAATATGTATGTCATATATGAAAATCAAAAGGACTGGGACGAACACGCAGAGC
GATTAAATTATGCGATCAACACCGCTCATGATTGAATTCGTGGAGACACAACGTTTTACCTGATTCATGGTTGGGACCCAAGGTCAACCTTGAAAGCCAC
CTTACCGTTGGAAAGCACTAAACCCCGAGATCGAGACGCAAGAAGGTGGAGATATGGCATTCAACGCCAAAATCAGCGTGCACGGGCGGTAGTGAATGAA
GGATTGGAGGTTGCGATCAAAGGTCGAGCCGATAGGCATAATGAAGATCGAGCTGTATTTGGATATCGATAGCGGGTCACGAGTTTGGCTATATCTGGAC
CGAGACAAGGAAGGATATGCTCGGATGCTAGCTCATATGTGGCATGGACCTTTTCGGGTGGCCGAAAAATGCGGTGTTCGCGCTGTAAAGTTGGAAATCG
CGGGTACGCCGTACCGGCTATTCCCAATGATTCTCGTTTCTAAGTTGAAGCTAGTTCGCGTATTCCCCGAACGACCTACGAGTAGGCTGAATGTGGATGA
GGCAAGTGGATTCGATTTTGACGAAGCACTGCTGCCGGAAGATAGCTGGGAGGGTGATCTTGACGCAGACGAATTTGAAGTGGATAAGATTATCGATGTG
CGATTAAGACGGAAGACGATGTATGGCCGATTACACAAGAAGTACCTGGTACAATGGAAGGAGCACAGCGACCCAACCTGGATCGACGAAGCTGATCTAA
ATTGTGGAGCTAGATTGCAGGAGTTCGATCGCGATCGGGTAAGCAGGAATCGTTCTGAGGTGATGCAATCTCACAAAGAAAAAGCCATAGATTAGCGATG
ATCGGAGAGTTTAAGTGGATGTGTCTATGCAGGGAAGGTGCATGGACAGGAACGGGAGTAATGGATGCAAGGAGAATGTACATGGAGATGGAATAGAATT
TATGTAAATTGAGTGCGATGACCGCAGACCAAGGGGTGCGATCACGATGAAAAGACGATAAAAAAGAAGGAAAAAAGACAAATATGGGAGCGATCGAATG
GAAATGAGAACAAATTATGTTGAGAGATCGCGTTATGGGACTAGACCAAAGAAATTACTCGCGTTCAAAGAACTTACCAACCAGGCGTGGAAGAGACGAC
CCAGGGTGGGGGGGGCGATTGAAGTACGAAACTGGTTCCTCCAACGCTCGGCCGAGTGATCAATCGACAGAGCGGTGATCAAGTTGGGTAGGTTGGCCCG
CTGCACGGACAGGCCGGGATACCACACTCTAACATCGTCGAGACGGGGAAAGTACAGGAACATGGAATCCAGCAAAATGTCCAGATCGCAAAGACCGTCG
ATCGTGCCCTGCTGCAACACCCTTTTTCATCTAAGACCAGCACAAGATCGTCTCTGCCTTCTTTCTTGCGCAAAGGCAGCCAACTCAGGGTCCGACTTAC
GCTGCGCAGGGGAGATCCACAAAAAATGTGATGCTTCCCACAAATCTTGACGATGATAATCCACTAATCCTTTATACGCCTCAACCAGTTTTTTTGAACC
ACACGGAAGACTTGAACGAGATCGGGCGTACGATCTGATCGTATGCGTCCCACGGTTGCTGATCGTAGAACTGTTTTGATCTTAATGGACGAGATCAGCT
GGGATGACCAAGAAGATTTCGGAGGGGCGCGAAGCTTATCGTGCTGGACAGGGAATATGTATTACTTGGACTTTGAGAAGTGGTAATAGAACAAGTCTAT
GTCCTGTTCCGACACGCTCATCAGGCTGACTCTTCGAGCGGATCAGGCGGACGCGTCAACCGCCGATCGCGTAACCCGATCACGGTACCCTGGAATCCAA
CGTCGCGGGTTATGGTGGTGTCAGGAAGAGGGTAAACTTTCCTCGGAGATCAGCAGCGAATTACACGGACTTCGTGGATCAC