Description :
From Genome Similarity Track
Location :
Scaffold_368:4450- 7414
Transcript NameFunction/comments
Phymu_g9158hypothetical protein PHYSODRAFT_532111

Sequence
2964 bases(100 bases per row)
CAACATCATGgtcacgtccaagtacacgGTCGTGAGCTTCGTGCCTAAGACCATCTTCGAGTTCTTCCGTGTCGTTGCCAACGTTTACTTCCTCCTCATC
TCGCTGTTACAGGTAAAGTTCCTCTGCAATTTCGACAATAATAACGACTGATGCAAATCTAATTGGAATATGTAGCTGGCGACGCCTTGGTCGCCAACGA
ATCGGTTCACAACGGCAGGACCGCTGTTATTTGTGCTGTTAATAACGATGGTAAAGCAGGGAAGTGAGGACTTCAAGCGCCACCAAGCAGACGACAAGCA
GAACTGCCGCTCTTGCCGTGTACGTCATTTTGTTTTTAAGCTGTTTACTTAAAACAATAAAACACTCACAATTCGTGTCTTCCCCCGCAGATTATCAATG
TTGGAGGACAGACGGAATTAATTGCATGGCAAGATTTACAGGTCGGACAGCTCGTTTGTGTGGAAAACCGCGAGGAATTACCCGCAGACGTGATCATTAT
CGCCAcatctgaagaagaaggacggtGTTTTATCGAGACTTCCAATCTAGACGGAGAGACGAACCTCAAGCGTCGAATAGCTGTCAAACCTACAGCACAA
CTCGTTGGCTGGCGGGAGCTACAGGGAGCTCCAATCGCCCAAGAAACGGTGTGCGCTTCAGCTGTTCGGCGACTACGAGGGTCAGTGGAGCACGAACATC
CCAACAACCAGCTCTACACGTTCACTGGTCGGTTAATACTGCGTGACAACGATCGAGGAGAGACAGCAGTGCCTTTAGGCCCCGAAAACCTCCTTTTACG
CGGCTGCAGCCTCCGAAGTTGCGCTTTTATCGTTGGTTTGGTGATTTTTACGGGCTGCGAGACGAAATTACTGCAGAATTCACGCGCAGCACCTTCGAAG
CAAAGCAAATTGTACCGAACAGCGAACCGCTGTATGCTGTTGATTTTCTCGACGATGTTTGGCCTCTGCTTAGCGAGTGCAATAGCAGCTTCGCACTGGA
GCCAAAAGAACGCCAACCGGGTGTGGTACCTGCCGTTTATCAAGGAAGCGGACCAAGCGGACGACTTTatcgtcaacttcttcacgtTTCTGATTCTGTA
CAACAACCTCGTGCCAATCTCTCTCTACGTTTCGTTGGATATTATCAAGGTGCTACAGGCTAACCGCATCACGGGAGACTCCAAGATGTCGTTCGAAGGT
ACCCATGCGATAGCGCGCACATCCGAATTGAACGAAGAATTAGGCCAAGTCGAGTACGTTTTCAGTGACAAAACGGGCACTTTAACGTGCAACGTCATGG
AGTTCCGCAAGTGCTCTATTGGTGGCATTTCCTATGGTTTTGGTACTACGGAGATCGGAcgagctgtagctgctttAGCCAGTGGGAACCCcccagcgaa
gaagcagagTCCAACGAAAGCGAAGGTTAACCCTTTATTGGCTAAGGGTCAAAGCTCTGAAAGCGGCTTGAGACTGGACATCGGCTCTACAGACGACGTC
CGTGACGCTGTACCTGCACATCCacctcaaggagaagaaggttgCGACCCGAAAGACGCGCAGGTTCACTTTGACCCTCAGATTCACTTCGATGACCCGG
GGTTATTACGTGCGTTATACGCTGGAGGCAAGCAAGGTGGACTCATCCACGAATTCCTCACTCTATTGGCTATTTGCCACACTGTAATTCCCGAGACGGA
CGTTAAGACTGGAGCTGTAGCTTATCGAGCCTCCTCTcccgacgaagaagcgctggtgAAGGCTGCCAAGTGTCTCGGGTATAACTTTATCGCCCCTGCT
CCGCTCATGAAGGTTGAGATTTCGTGCAAACCATCGTTACTTCCTGCCAAAACCGGCGTACAAGAGCCCCGGACGAAATGTTTCACTATCGTGAACGTGA
ACGAGTTCAACTCGACCCGTAAGCGCATGTCCGTTGTGGCGGTGAACGAGGAGACCCACGAATACGTTTTGTACTGTAAAGGCGCGGACAATATGATGCT
ggagcgagctgcagctgaaaaaAACGATAACGATACTGCTGCTCATGCGAAACTGGTAGGACATTTAAAGAATTACGCACGTGAAGGTCTACGAACGCTG
GTGCTTGGTCGAAGAGTCTTAACGGAAGAAGAGTACCACGAGTACAACGAAGCGTACATGGCTGCTTCGACAGCTCTGGACGACCGTGAAAGGAAACTCG
ATAACTGCGccgagatggtggagaagaacatGCAGCTATTAGGAGTGACAGCTATTGAGGATAAACTGCAGGACGGAGTTCCCTCTGCCATCTTCGATCT
CGCACTGGCTGGTATTAAAGTCTGGGTGTTAACTGGAGATCGGGAGGAGACTGCAGTCAATATCGGCCATGCTTGTCGGTTAATTAAcgacaagatgcag
ctgctgtacgtgaaTGCAGAGCGTATCGACGCTCTTAGTGCGCAACTGGATGCTCTACATGAGACTCCCGAGATCCAGCGGCTCATTCGAGGCGGTCAAA
TGGCTGAGAACCTCGCGATGGTCTGTGACGGCAAAGCTCTCGTCCATATCTTCCCGTCCCGTGATACTCGCGTGAAATTATCCACTGAAGCGGTTCAGCG
GGTAGAAAATCTAAGCCAAAAGCTGTTGGATATCGCTCAAGTATGTAAAGCATTGATCGCCTGTCGAGTGAGCCCATCGCAGAAGGCGGAGATCGTGCAG
CTTGTACGTAAGGGGGCGCGTCAGGAGCGTAAAGCTCAACAACCGATCACTTTAGCTATCGGAGATGGAGCTAACGACGTGAGTATGATTCAAACAGCTC
ATGTTGGAGTCGGGATCTGTGGGAAAGAAGGGGTGCAAGCTGTGAACGCCAGTGACTACGCGATCGCTCAGTTCCGGTTCCTTACGAGACTGGTACTACT
GCACGGGAGGTGCAACTACAAACGTGTGTGTAAAGTCATCCGCTACTCGTTCTACAAGAACATC