Description :
From Genome Similarity Track
Location :
Scaffold_2075:445- 2128
Sequence
1683 bases(100 bases per row)
CGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGCCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGA
TCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACAT
TTAGTCGATGTAGGTATTTCAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATCGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTG
GAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATATCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAA
CACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACT
CCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATAT
GCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTTCGTCCACTGAGTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACT
TGTAGTACGGGCGCTCTCATACCCTGTTTGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTG
TGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTCGCTCGATC
GTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCCTTCGCGCTCACAGGGACTTCCTGTCCTCGGCTCCTCGCCCGCGCTTCCAGC
ATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTTATCCTCAGCGGCAGATTCGTAGTTCGAGGATGCAGCCTGGC
TGACCCTCGGCGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATC
CAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTC
GCCGTTTTCGTTGGTGCTCTCACCGGTTGCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGAAAGTCGCGTAAAG
CTTGGTGGCGATACACAAACTCGAGATCCTTGTCTGACCAGCCTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGT
AGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGAGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGT
TTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGG