Description :
From Genome Similarity Track
Location :
Scaffold_956:445- 2108
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_956-snap-gene-0.3Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
1663 bases(100 bases per row)
CGTGTTCTGTATGTTAATGTAGTTGTAACTTGAACGCATCCCTGACACGTACTGTCGGTAATCAGTCCAGCAGTCGAGGCACGCTGGTTAGCGTTCGGAT
GCGACGATCGAACTTCAAATAGCAGCCCCGATACATTCATGAAGCGTCGCATCCATTCACAGGAACTCTGCTTGGTCAAGGGGACGCGCAGCATCAccaa
aaGAAACCTGTTACGCCGTAtAcccATCGTGAAAGTTCTCGTTCTTTTGAGTCATTGTGACTTTTAGAGGCTTTACTATAGAGCACCGTTGATGAAGCTT
CAGACCCCACGAAGATACACTCCAGAATGTGTATCTCACGTCGACTATTTGACGCAatGTCAaCGTCGAAcacACGGATTGCTGCTAGGATATGGAGGGA
CGCTTTATCATCGACCATGCCTCGAAGTGTCACGCCACCATATTCATTGCCGCGTACGCCATGAAAACAACGGTCATTGTAAgCCATCTCGATATTGCGC
AAGAACATGCCAGGTTCAAAACCTgatCTTCTGTGGTCAGGTATCGGgGTCGTTTTATGTGCAATATTACCCCGGTAATGTGACGTCGTACATGTCACTA
CTTTTGGTTGTTGGTGGAGGCGTGCTCATGATGCCAGACCTCCCACCAATCTGGACAGGTATCATCAGCGCATAGCAACGATTGAGCTTCGCAGCTTTAT
tATTGAAGAAAAaGAACGGACACTACTGGAAGAGAGACAATATTGACACCTGTGCGGGCGATTACAGCGAGTACATCTTGATCTTGAAGAAGAAAATGCC
GACGATGACGCCGATGAGACTCATCACACCACCCAGGAATACaGGCAGCTTGTATCCGAGTgAaGTCTCGACGATGGCAGCTCCAATGGCAAAGTTAAGC
AGCTGaCCGAaGCAGTTAGCAGAGTTGAGCGCACCGACgTAgATACCGATCTCAGcTTGTCACCGAAGACGTGGACAATAATCGGCACAAGAAGCGCAAA
CACGGTGCCCTGGGAGAGGGAAGTGATCACGACGATgAAGACGTCGACTGCGACGACCTTGGTGAATGCCATGACCATAAGCAGCGACTGTGGGATGAGG
GCGATGACGAGAACCCACTTAGCACCGAGTTtGGAGACcaGGAATGGCAGTGTCCACGAGTACAAGTACCCcAcACCGTTAAAGATAAGATCTGTCGATC
CACCAGCGACCTTGACACCATGGTTGTAGTTGTCTTGCTCCTCGGTACAGTCTGGCGAGCAGTTGTCGGCGTTGTCTGGCGAACCaTCGTACACCTCAAT
ACCGAAGAaCTGACCCTTGTTGCCGTTGTAAGCCGTGTAGCCGTACTGCACACAGAAGAAGATGAAGCAGTAGACAACCAACACATATGGCAGCATTCgA
aGACCCTTCCAGATCGAGTAGAATGCCTCGCCAATACGCTTCCAGACCGACTCCGAGTCAACCGACTCTGGGTCAAGTGGCTCCTCCTTGACGACGATGC
ATACGGCTCCAACGGTCACCAGCATGACAACCGCCAACATGCCCAGGAAGTAACGAAGCGTCAAGTGAGCAGCGCCAAaGATCTCAATGTAGCCCGACAC
CATGATCGAGCCAAGCGTGGCCCAACCTTGAGCAAATGCAGCACCCGTCGTCTGGCGGTCACC