Description :
From Genome Similarity Track
Location :
Scaffold_12:44483- 45765
Transcript NameFunction/comments
Physo_156179hypothetical protein

Sequence
1282 bases(100 bases per row)
TCCACTGAAGACGCAGGACGAGCGCGGCACGTGCTGGGACTTCGCTACTGTCGGCGTGCTGGAGAACAGCTATCGCCAGCAGGGAATCGCCCACGGGTGG
CTGAAGGAGGACGAGTACATGGCCATCTCAGAGCAAGCGTACGGCGCGGAGGTGCTGCGACTGTGCGCGGGGCCTCCGGGCTCCCCGCAGCAAGTGGCGT
GCTTGATCCCGGACAACGGCATCTGGAAGAACACGACGGAGGGAGGGGATTCGACGCTGCTCATGTACCTCATGAACGGCCTGAAGGACAACATCTACCC
GCACTCGATCTGCCCGTACTACCCTGACGATGGCAACGACACTGTGTGCGCCGGCCTGACGCCCGAGAAGCGCAAGACCAACCCACTGAGTCTCAAGCTC
AAGCGGATGGATACACTCATGGATGAGATGTCGATCAAGCGCGCGCTGGTGAAGCACCGCCAAGCCATGTCATTGACGACTGCGACGCCCTACACTACCC
ACTACTACCCGTGCATCGGTGAAGTTGCTGGCCAAGAGCGATGCGATCCAGCGTCGACGTTGTGTACGTTGTGCCCTCCGGAGTTGGCGTTGACCACGTG
CTGCGTCCCCATCAACGGAGGAGAGAATTACAACATGAACGGCGAGTTCATCACCAGCCACGTGATGAACGTCGAAGGAGGGCACGTGATGACGCTCGTG
GGCTACAACGACCTGTTCCGCACCAAGCAGGGCTTCACTGGCGGCTTCATCCTCAAGAACTCGTGGTTCGACGGCATCCACCCCGCGCTCGGCCCCACGC
ACGCGCGAGGCAGCCACAGTCTCAAGTACTGGCTGCAGGAGATCACCGAGTGGGAGGAGGCCAGCATGTGCCCCAACAGCTACGACCCCGAGAACTGGTA
CCAGTGCGGCAACACGGCCGAGGTGATCGACGCGAGGCGCCACGGCAATGGCGACCCCGGCATGAACATCCCGTTGCCCATTCGGCGATCCAGCACCATC
GGAGGCGGCGTGGAGTCGTGTCTGTCGGAGGAGACGCAGCTCTACGCGAGAGTGAACCTGCAGCCGCTGCACTTGCGCTGCACGGACCCGAGCTTCTGCG
TCGTGAGCGACGACTACACGTACTTCGTGCGCAACACGACGCAGTGGGGGGACCGCATGCTGCGTATGTGTCTGTTCGAGTACGACGCCATGACGCGCAA
CTCGACGGAGCTGTGTCTGCCGCCGATGCTGGCGCAGAAGATCGCGTACGTGCTGTCGCCCGTGCCGGAGGAGGTGCGCGAG