Description :
From Genome Similarity Track
Location :
Scaffold_424:4448- 7625
Sequence
3177 bases(100 bases per row)
GTTTTAACGTTCTACTTGTGAACATAACGGACCAATTCACTCCATCATGTTCCTGTAGCAAAGCTGCGGATACCGCCCATTTGCTATCGTAAACCACGAT
CACTGGTCGGCGGTCTGGATCAAAATGTTTGAGTACCGAGGTTTGGGCTACTTTAGCCTTCAACATGGTGAACGCAATCATGGCCTTCCCCCAACGATGA
GCACCAGTATGTTCTTTATAGGACTCTTTCACTTTAACTGGAGCCTGATTATTCGTTGTCACCAGTGGATGATCGTGATCACTTGCTGGTCGCTGCCCAC
TGTCATCATCAATCTGGGTATTATAGCCATGATCATTGCTGGGTGAGCCTTCAACTTCCGTGCTGTGAGAACGCCTGATCTCATGTAAAACAGCTTCCAT
CAATTTGTACAAAACCGAGGCGTATATGGCGAAGTCTTCAATGAACTGGCTGTAATAATTCAGGCTTCCGAGGAAGGACTGTATTGAACGCAGTGCCTGA
GGAAAAATAATACTCACCAACGACCCCAAATCCGTCGGGTCAGCTTCGATTCGTTTTATTGACACTTCGTGCCCGAGGTACTCAACCTTGTTTCGTCCCC
AGACGCTCTTAGGTAGGCTGATCGACAACTTCCAATGATCACACACTACCAACAATCTTTCCACCTTCCGATAGAGAGACGTCCAGGATGACGCTGGGAT
TAGAATGTCATCAATGTAGGACCTTCGTCCTAGAATCGAAGGGTTCCTGTGAGGGTTTGGTTCGCCGTCCTAAACACATCGACCTGTTGAGACGCCTCGT
GGTCATTTGACTTTGGCCGATCTCCGATCATAAAATATCCATATAACGAGTTATCCACAGTACGTTGATATATTTGCGGCACGTTCTTCAGAACGAACTC
CATGCGTAACCATTCATACAGACCAGAGGCGTGAATAAAGCAGAGATCATTCGTGCTATTTCCGTCATCTCCACAGCCCAGAATCCGCTGGCCATATCCA
ATGAACAGTACCATAGCGCTTTGTCGAGATCCTGCAGCAAGTCGTTGATCAGGGGCATACGATATATTATCAGTATCATCAATTGGTTAACTCTTCGGTA
GTCTATACACAGTCGCATATCCACCCCATTATTTTACACGATCACTACGATCGGCGACGCCCATGGCGAAGTTCAGAGACACATGATTCTTGCTGATAGT
AACCCTTTAATCAGGTCCGCCAACTTTTCACAGAACTTTGGGGCGACTGGCCTTACTCGTTGTGCGATTGGGATTGCTCCTCCAACATCTACATCGCAGA
TTACACCTCGAGCAGCATGTGAGAAATCATTGTCTTTGCCCATCAAAGGGTATAGTTTTTTCCAGATCAGCTGACGTAATTCTTCTTGCTCTTTGGTCAA
TTGGACCCCTGGGTCGCCCACCTGTATGTCGTCAATTTTTACCTCGCTCAGCATCACGTCTACATCTGGTAAGACTGCCATGTGTTGGCCAACGTCTTCC
TCGAACAACACTCCACTTTCGTGCTGGTATGACGAGCATTCGCGTGCTCCTTAGCTAGTGATCTCTGCCTTTTGGTTCGTCGGATGGTCGGACGGTCGAT
GCACCTCACCATCCTTAACAGTAGTCTCGTCTGGGTGATTGGTGGACTGGTCGTGCATACGATCAGTACCATATACTTGATCGGTTCGAGAGTGAGTTTC
CCCTTACACTCGTTTGGCTGCGTTTCTGACTGGTTCCGCACCAACGCGATGTCTTCCATCTCGTTAACGGGGGTGTCTATGTCGACAGTTGCTGGTAATC
GCGTCGATATTTCTCTCTGGGGTTCACTCTTTTTCTACAGCTGATCAGACACCGAATCACAAACCACATCACCGTCATCCCCGTCACTAGTCCTACCAGG
TATGGTGATCGCGTTAATAACCACTGGCGATTGTCCTGGTTGTGGTCCTTCAAGGTTATTATGGTCGTCCACGTGATCACATATCGGCTTCCAACTCTGC
TTCCTCTTATTCCACGGCCGTCTCTGCGATATCCTTCGGCGGTCGTTTAGAATGCGCGTTGGCGTTGGATATGACGAGTGTTCGACCAACGGTTCATCTA
CTTCAGGTAATTCTTCTTCTTCTTCCTCCGTAGTAGCTTCAAACGCGAGTGTCTCCCAATCCTAATATCACCGTGACCCCACGGACACATCCCCAGGTGA
TCCCGGTATCATATCCGCCGGTATCCATAACCCGAATGGCGTCCCCTGTTGGATAATCACCTCTTGATTATTCAGATTGGTCAAGCGAAGGTACGTTAGA
CTTTCATGTCCAGTCGTTACCTGTAGGTACCCAGCGTGAGTGGCGTGTTAGCCACAATTTCGACTGCAGTGGTCCTCGACCAACGTTGACTTCCACGGAG
TTATCCACTGGGATCGCCAAGTAATTTTCGTCCGCAGCGATTCGTTTTATCTTCGCCCCATACGGTGGTCTTCTACCTTCTGTTAAAAGTTAGCGGAGCG
TAAAAGTGAAGGACACTTGTTGGTTGAAGCAGCAAAACCAAAAGTGCATTACGTTATGAATGGAAACTCGTTCCTACCGTTTTTACTTATCTTTCCAGGT
ACATTCTTCATTCCAACGTCCCATCAATCCAGAAGCTCCTTTCCCATGTTCCTTTACCATATTCCTTTCCCATACAACTGTTTCTCTGATGTGGCCACAC
AGCTCTTCCACACAGCTCTTCCGTTGACAAAAATGGGGGACGTCACTGTCTGGCAGGAAAGTGCTGGTAAACCCCGGCACACCAGTACCCGAAGGTTTTA
ACTTTTTATTTCGTCATAGATATCGAACCAATGAACTCTCGCTTACCACTTGAGCTACGAGTTCATATAGATGGCGCACTCTGTTGTCCTATAATTGTAG
TACTACTTAAAGCATGTTCTGACTCATGGACACGCTTATCCCTACGCATGTCCATAACACATATGTCGTATCACCTATTCTTAAGACATTCCAGTTGAAT
TCTGGCTTCGTCCGGCAAAGAAAACTGTCCCGTCCGCCAGGTCAAGGCGTATTCCGGCCGGTACCATGAAATCCATTCCTAGAATTACTTCTTGTACCAC
TTGGTCACCGACCCATACATCAAAGTAGTAGACTACTAGTGACCCATTCAGCGTGATCTTCACTTTCGTGCGGCCTT