Description :
From Genome Similarity Track
Location :
Scaffold_723:44479- 45896
Transcript NameFunction/comments
Phyin_T30-4PITG_21627Putative uncharacterized protein

Sequence
1417 bases(100 bases per row)
GACTATACATGTTTGCACGCGACAGCGGTTTGTCAAAATTTCGTATCCACATAGCTACATTGTATATGCTAACTTAAAGGTTTGGATAGGTTTACGTATC
AGTTATTTGTTAGAAACATGTTATTAATAACCAAAGCTGATGCATTTCACGGAATCGAAAGGATACCAGCGATGCTGGTGCGCACGAGCCGGCCTGTGCG
CCGGCCCCCCCCCCCCCACCTAAAAAGAAGAGGGGCCAGTGTGGCTCACAACCGCCCCGGTGTTTCCCCCGAAGGTAAGTGTTAAAAAGAGTTTTTTAGT
TATGGTTTAAAAAAGCAAGAAAATTTTAAGCTAGGTATGTGGCCCCCGGTGCCGAACTGCTGGACCGAGGTGTACCACTGGAGAGTGCGAGCACATGCGA
GTCTGAATGCGACGCATAGTATGCAGAGAGTTCCCTGCTGGAGTATCAAGAGCGGGAGAGCGAGCTGATACAGGAGAGGCAGCAGGTCGGCCCCCTTGAA
CAAGAAGGAGTAAGGCTGGTATCATTAGTATAATAGTGGATTATACTGGCTAGGCGTACGAGTATGCGGTGAAAGTGGAGCAAGAGGGCAGAACAATCAT
GAGCAAGCTGAATGAACACTTGTCGGTTGTTGTCTCGGAGCTCGCCAAGAAGGAAGTGTACGTAATGTCATAGAGTTGTTAAAGCTGGAGTTTTTAACTG
ATACCCTTGACAGGATGGAGAAGGAGCTGCAGCAGGCGAAGGAGCATTTAAAATTAACAGGGCAGCTCTCGAAAGAGCTAGCTAGTGCCCAGCGAGAAAT
TCGTGAGTTACGGAGAGCGAACGACATCCAGTATATTCTCAGGAGAAACTACTCAAAACCTGCGAAGCTTGTGTCGGACTCGAGGATACAGCCACGTGGC
AATGGTAGACCTGCACGCGCTAAGTCAGTCCCCGGAGGATTGTCTGCATCAATGAATGACGAGGAGAACGTCTTCTCGTCACTACCAGACAACGTGATGC
TCAAGCTGTTTTCCTTCTTGGACGAGGACAGTATGGTCGCAATTAGCGTCACTGATAAAGTGCTGGTGAGGCGAGTGAATGTGATGTTTGGAGTCACGAC
GCCTTCCAGCTTGGCCTACAGCGCTCCCCCAGCTCCAGTTAAGCGACCTGCATCGCCTCCACCTAGAAAGACGTCGAAGGGCCGAAGTCTCAGCTTCATC
GGGTCGTCAGAGAAGGACAAGGTAACTACTGTAGCTGTTATGTTCGACTTATCAGTTATGCTAATAGTGTGCTTTATGCTGAAGCTCTCGAAGGTGGACG
CGATCGTGAAAGCACTTAAGCCTGACCAGATCAAGTTATTCCACGATATGTCAACTAGAGTGAAGACATTAGAGGTTCAATGCCTGTGCGTACGTCACTG
TTATAACAGATAAATCT