Description :
From Genome Similarity Track
Location :
Scaffold_677:4447- 9072
Sequence
4625 bases(100 bases per row)
TACGGCTTGAGTAAGCCAACGTATAAAACTGGATGCGTGCGCATCTTCTTCGGAAGGTTAAGCGTATACGCTAGGCCCTTCTTGGCCACGACCTTGAACG
GCCCTATGAACCGTGGTCTCAATTTTGTCTTAAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTGGCATTTAATAAAACTAGGTCTCCGACCTCAAA
CCTTTCTTCATTGCGTCTGCCTTTGGCATCTGCATGTTCTTTTTGCATGTCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTTAGTCTC
AAAGAGACAAAGTCATCGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTG
GCGGCGTCAATGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCAACGAG
TGGGAGCATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCGGTTTGACCATCGGTCTGC
GGATGGTCCGCTGTGGACATGTCCAACCGAGTGCCAAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTG
CCTCAGGCAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAAATGAGCCATCTT
GCTCAATCGGTCTACAAAGACCACAATACCCGTGTTTCCTGCCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTG
AGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCAACCCACTTATACA
TCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATA
CTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTC
GCGCGTAAGCGCCCAGACAATTCCTTGTCCGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTC
CGCGTATCAAGTCAGGCACTGACGACATCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCC
CGGCTTGTACTTCACCTCGAAGTTATATTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGAC
GCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTG
GATAGCTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAA
ATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCG
TCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATCTCCGCGTAGTTCGCACTGTACTTGTGCAAGTAAT
TGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTT
CCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCT
CGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACGAATATATCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGG
GCCTAAACAGCTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACCGCTCGGAGTACT
CACCGCTGTCAGCGGAACGTCGCTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAGCGTACAGCCTACCATGTTGTTC
TGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAATGCGCCACTTGCCGTTCGGCTTTC
TGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGACGTCACACTGCTC
TTTCAACAAAGGCCATTGCCTTGTGTATTTGGTTCCAGGAGCCAGGTCAATCTCATGACACACGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTT
CAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGCTCAGCGCCTTCTTGGTGT
CCTCTAGGACCGCGTCGTCCACGACGGATGAGGAGTTCAAATCCTCCTCAGGTCCCAGCAAGACCACCTCGGCTAGCTCGCCTGCCTTTAAGGCTGCGCC
GAACTCGGCAATGGACATCTTGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTATCAAGGCTGATATCGCCTTCTACCTCCCCCGTCCCTCCGTTC
ACGAGTGTATACAGCTGTTCACAGCAATCACGTGGAGCATCACCGCTCGTCACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGCCTCAGC
ATACAGCTGACTCTCTTTCAGGGTGGAGCGACAGGCGTAGTTGCCCGAAGGCTCTCGAGTCCATCAAGACTCTTCATGGGCTTTGCAGAGACCTCCACGG
TCGCTTGAACGACCAGCAAAGCCCGGCTTGCACACACTCTTTTTCGTAAGAGAGCTCAGCTCTCTTCGGGGGCTGAGCCCCATTGACCTCTTCCTCTTCG
AGGCACAACAGAACTCAGTTCTTTCCCCAGTAGGCCGCCCCGCGCCTACTGAAAAGTTGCCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCGCCGGAGC
CTCGCGCTTCTTGCGCAGAGGGCAATAGGCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGCAAGAAGC
TCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCTCTGGACCGCTCGAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCGACCTGAAGT
TGTGCTCGGCATTCAATGCCACATCCACCGCCTCTTCAAAAGAGATAGGGTGTACACGGAACACTTCCGTTCGAGCTGCGCTCACACGAAGTCCCTCCAT
GAACACGGTCACGCTGACCAGTTCCGGAAGAGGGTCCGCCGCCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCAATAAATCCTTCTTACCC
TGGCGGGTAGCAAGGAACTTTGACC