Description :
From Genome Similarity Track
Location :
Scaffold_30:444659- 448256
Transcript NameFunction/comments
Phyra_7160560S ribosomal protein L35a-4
Phyra_78316Hypothetical protein

Sequence
3597 bases(100 bases per row)
TAATATAAACTTCCAAAGGTCTCTGCCACTGGGCGTTGGCCGCCAATCGATTGGGTCCCAGTCCGCAGCACAGTCGTCGTGTACGCCGCCCACACCTTCA
GTCCCTCGCTCGTTCAATTCATCCGACTGGTACGTGAGGAACTTGATGCCCTGCGCCCGCCTGCGCCTCCGTTCCCCCATGCAGCCTGCCCATACAACAG
AGAGAGACCGCGCACCTCGCAGCTCAGACAGGCGCTCTGCAGACACAGGACGACTCAAAGCTCCCAGTAGACGCACGAATGTCCAGGAGCGCTCACTCTT
TCGATATGGGATTTTAAAGGGGGGAATGGGGACAAGGCGGCGGACTATTTATCTATAGGTGCAGGATTATTTTACTGACGAGGGTTGTTGCTGTTTGGTG
ACTAGAACTCTGTTAAAATGGTCGCTTCCGCCGGTCAGCCTACTCGTCTCTACGTCAAGGGTGTGTTCCTTGGCTACAAGCGCGGCCTGCGCAACCAGTA
CTCGCACACGGCGCTGGTGAAGGTCCAGGGCCTGACCGACAAGAAGGACGTGGACTTCTACCTGGGCAAGAAGATCGCCTACATCTACAAGGCCAAGTCC
CTGAAGAACGGCTCCCAGTTCCGCGTCGTGTGGGGCAAGGTGATGCGCGCCCACGGCAGCAACGGCGTCGTGCGCGCCAAGTTCGCCAAGAACCTGCCGG
CCGAGGCCATCAGCAAGAGCGTGCGCGTCATGCTGTACCCGAGCCGCGTCTAAGTGCGTGCGGTGACTCGTGCGTTCTCAGCAGCTTTGGTAGCCAAATG
ACAACGAAGAGGGATTGTGACAACACATCGAACGGCGTTGCCTTGACTTTCTTTTCACTTCTTGCCTTCGCGTTGGTGCTCAACATTCTCGCAGTTTGCG
CTGTGCTATCCACTGGTTTCTGAGCTTCTTCTCGCTGTTGGATGCTTCAGCTTTACTGTGCAGGGAATTGTTTGGTTTCTTGGGCTGCGGATAATTTCCA
TTCTCCATTGTCAACCTGCTGAGAACTGTAATGGCAGTGTGCTGAAAATCGAGCAAGGAGAGGATAGAGATAAACACTGATGCTGCAGTTGAAGACAAAG
GCAACGGGCGCTCCACGCATTCCAAGAAGCACCTTACTAATTAGGTTTTAACGACGAAAGCGGACGGACGGTGGGCGTGACGACACATACGCACTTGGCT
AAGCAGTTGGGTAGTTCTACATCTCAAACTCCTCATAGTGCACATCGAAGATGCCGGCGAAGTTGGAGGCCTCCGTTTCCACGGCGTGGATAAGACCCAT
GGGGCCTGATACCCACGTGCCGATGCCAGTAATGTTGACGGCGAAGTTGTGCGACTGCTCCTTCACGACCTCGTTGAACAGCTCCTTCACATTCAACCGT
GAGCGGCTAACAGGGTGGTGGAACTGAACCTCCTGGCCATCGAACGAGAGCGAGTGCGAGTACTCCGAGCCGCCACGGTCGACATTGGCCATCGTCTCCT
GCGGGCCGTAGCTGCCCAGAGTAGGCATGAGGCGCGACTTCTCCATCCGGCTCATAGAACGCGGGGTGGGCTCAGTGAAGACCACGGCCCAGCCAACAGA
GGCTCCCGCAATCATGATGAGAACCTCCACGACGCGCTGCATTGGCCACATGTTCTGGTTAATGCGCAGAGCGCCCAGGATCGGGTAGTTGTACCGGATT
AGGAACAGACACCAAAAGCTGCAAGTGAACGTCACGAAGAACAGCAGCATCTGACGAGGCACAGACCGTGACGACTGAAAGAACGGACGCGTGGGGACCA
TGCTCGTGTCGTCCATGGGCTTGAGAGAAATGCCGTTGGGGATGCCTACACCGCCAAGGTGCTGGTCACCCGTAAAGCACAGACGAACCTTGAACTTCAC
ATGGTCCGGGTCGTACTGCTCAATGGCATCGAGAAGAGGCTCGAACTCGTGAAAGATACCGATCTCGCGAGACGTCCAGTGGAAGTACACCTGCGTGAAC
TCCATGTTCGGGTCGTTGTTGCGCATGCAGTCCAAGATCTTGCCGACAATACTGATGACGGGGGTCGCACCAATACCACCAGCCACGAACACGAGCGCAG
GGTAGTGCTGGAAGTCGTCGGACATCTTACCGTAAAACCCGTCAACGTAGATGAGTGGCATCTTGCGCTCCTCTCGCGCCTGAATAGCCACTGCATACAA
CGACTTGGTCCAGTTTCCAATGCTTTTGACGTGCACCGTGAAGGTGTCCTCGTACTCAATCGGCGACGAGCTGATACTGAACGGGTGCCACTGCGTGTGT
GACAGCAGTGGAATACGCAGGTACACGAACTGGCCAGCATGGTAATGGCCAGACTTGCCGGGCGATCGGCGAAACACCAGGCGCGTGATCTCACCGGGGA
TGGCCTCCAGGTCGACAACCTCGCACGGCATGCGGCTCTGGCTTCGAGCTAGAATGCGGTGCATGACAAAGAGGCACACGGCCGGGTACATCCAGATGAC
GAACTGCGAGAAGTGCAGCGCGCTGAAGAAGAGCACGAAGATGAAGAGGTGGTGGCAGTAGTAGAACACGTCGTAGTACTTGCGGCGAATCGGGCTCAGC
GACGTCACGCCGATGATGAGGCAGCACAGCAGCGCCAGTTGGCCGCAGAAGTTCTGGAGACGCGATTTGCCCTCCGTCCCGTAGTCACAATCCAGGCACG
GGAAGGCGGACGCGATGAAGGTGCCGCTCTTGAGCCACGCGTAGTAGTACGGGATGGCGTGAAGCGCCACCATGGCCACGGTGAAGAACCCAATCCAGCG
GTGGTACTTGATGGCGTGCGAGTAGTCGATGCCCATGGAGATCATCCAGAACGAGTTCCTTGTGGCAGGGATGATCAACAGCGAAAAGCACAACACGGCG
TTGAAGCCGAAGACCTTCCCCACGAGCCGGAACACGGACGCTGCGTCAGTCGATTCGGCCTCCACGAGGTCGTCGTAGTTGCGCGAGAAGACGGCCGCGA
ACCAAATGGCGTTCAGTCCGAGGAACACGAGCGTACAGACCGACTCGGCGTACGAGATGTTGATAGTGCCCACGAAAATCTTGCGCTTGAGGAACCGCAT
GACGGTGCGATGCGCACCCGTGGGTACAGGCGGGAGCGCGTCCCCCAGCGCGAGCGCCATGCCGCCGATCATGAATGGCAGGCCGATGAGCACGTAGTTG
ACGACGAACTCGACGACTTCGCGGTGTCCGCCGACCCACGCGGCGTCCTCGACCGTGGCCCCGAAGAGAATGTAGAGTTGGTAGCGGAAGCCCACGCGGT
ACTCGGGCAGCTCGTGGTAGATGATGGCGAAGATGACGAGGGTGGCGCACAGGCCCACGGTCAAGAAGGGCCACGTCTTGTACGTCTTGTCCACGGGCGT
GCCGTACACGAAGGGCGTGGCGAGCTGCGACGGCTTGCCGGCCATGTTGGTGCCGCTCACGCTGAGCGCGAAGAATTTGCTCTCGCCGCGGCTGCTGTCA
TTGGCGGTGCTGTAGCCCGCGGGCGGCTGGCGCAGATCCAGCGAGTCCGCGGGCGAGTCCAACACGTTGCTGTCCATCGAAAGGTTCACCATGGTCG