Description :
From Genome Similarity Track
Location :
contig_120:44463- 45985
Sequence
1522 bases(100 bases per row)
GGATTAGAGATGGTGTAAGCGGATCGGCTCAGTACTGTAGCTATTTTGCTTCAGCGTTCGGTTATGTCGGGGTATCGAAACGACGAGGCTTATTGAGAGG
GACCTCTGTGCTGTACGTCCACCTGCGAGCGTACGCCGTTGGCCCCTTCTTGGTACCAGTGTTCAGCGAGGCCTTTTCTGCCTGTTAATCCATGCCGCTG
TCGGAGGTTTCAACGCTCGCTACTGTGGAGCTGCTGGACAGCTCTCTAGTAACACCGATGGGGTCCGCGCATCGGCCAGACCAAGAAACTGGCGACTGAG
TGAGTGCTGCTGAGTGAGTGCTGCTGAGTGAGTGATGCCTCCACGAGCGCATTGCGGCTTTTGGAAGTTGCTGTAGGCTACATATCCTTTTCTATCTATA
CGGTTCGCATCAAGTACGATTGTGAGTGATAGTTTCTCTTCAAAGAGAGTCGCCCGCCTGTGCGCCGTCATCACCTTGAAGCGGAAAGGAGGGGAGGTGA
TTGGCGTAGCGCGCGGCGATGCCAGCACTGTCATTGCGCACTTGCAGCGAAGGCAGCTCGGCGAGGTCGACGGAGCGGTGGCTTGTACGGGTACCGGCAC
ATGTATGTACAGCACGCATCGACACGAAACGCGGCAACCCACCGTCTACGGGGACGGATTGGAGGGCGGAATCTGTATATCGCTTGAGCCAGTACATGGA
CCGGTAACAGTCAGCCTGCCTTAATCCTACCAAAAGTAAAGATACATGTAGATATCCGCCAAACTCTTGGCGGTATAGTTATTGCTTGCATAAGGTGGCT
TGCTGTCGTTTATGGTAATGGTGAGTTCGATCTAATATGTACATGTTATCAAGATACTTCACTGTACTGTACTTCATATAAATTAATTTTCCGGTGCAAT
TGTTTTCAATCTTCTTCAGTTTTCTTTTTGGCGACTAAAATCGCTTTTCTTGTTCGATGTCGACGCTCGCTGTGCGAGTGCATGCCGACATATTCACTTT
TCGCTGTGGATGCGATTACTAATATGTATTGAATCCAGTCCAGACGACGTTGCCATTATTTTAATACCTACGTGTATAGTATGGAGAGACGTCCCATACT
GCAGCGCTAGTAAGGCCACTTGGGCCAGTGACTTGTCTGTCGTGTGCAAAAAGCTTGATCTCCACGAAGGAAACGAATCCCCGCTGTAGGAATAGTCGAG
AAGAACACCGACTATGAAGGTCTCAGACAGCGTGTCATCGCAAGCCACCGCTCCGTCGACCTCGCCGAGCTGCCTTCGCTGCAAGTGCGCAATGACAGTG
CTGGCATCGCCGCGCGCTACGCCAATCACCTCCCCTCCTTTCCGCTTCAAGGTGATGACGGCGCACAGGCGGGCGACTCTCTTTGAAGAGAAACTATCAC
TCACAATCGTACTTGATGCGAACCGTATAGATAGAAAAGGATATGTAGCCTACAGCAACTTCCAAAAGCCGCAATGCGCTCGTGGAGGCATCACTCACTC
AGCAGCACTCACTCAGCAGCAC