Description :
From Genome Similarity Track
Location :
scaffold_37:44458- 54237
Transcript NameFunction/comments
Pl_111491hypothetical protein PHYSODRAFT_496885
Pl_111492hypothetical protein PHYSODRAFT_359933
Pl_111493hypothetical protein PHYSODRAFT_354314
Pl_111494inositol-3,4-bisphosphate 4-phosphatase, putative

Sequence
9779 bases(100 bases per row)
AGCCAGCAGAGCAGTCACAGACGAAGAATCGAATTTACCCTGGATCATATCATAACGCAGTAGGTCTCCTTCGCAAGTTTGGAGAGCATTGTGACGTGGT
AGCATCCGTTTACTGAGCTCGCGACACAATGCGACCGGTGCTTTGCCATCTTCCTTGAAATTGAAACGCCATTTCGCTAAGATGAACGAAGCTCTTCGAA
CGCCCACACAGGTAAATTACCTGTTGCTGCCTCAACTGAAAAATGGTGAAGCGCGTCAAAGATGAACTGCACAACCAGTTCCCAGCAACGCAGACCTTCT
TCGGTTAGAGAAACCCGGATCTCAAACACTGTGCCAAAGGACCCAAATTCGTAGGCATCTCGATCAGAGGTGCCAGCAATGACATCGGTAGCCCACTTCC
GTCGTTTGAGAGCCGACACTAGAGACCCTGGGCCTTCATGACCCAACAAATGACCCACATAATACCATGGCTTTTGCCGATAATTCTCCATCATTGACGA
AAGCATCCAGTACAGACGTAGAGAGCGCTTCTCGCTAACTGGGATGACGCGTATGACCGTGGATCGCTGGCCTGCTCCACCTCCGTATGGCACCGTTAGC
GTTCTCTGCCTCGGTACGTCGTAGCTGCTTCGACAGCGTGGAATATTGCAGAAACTCTGCACCACGTATTGCTCCAATGTATCTAGCGAGTCACATCCAT
ATACACACAGCTTCATGGCCGATGCCACGTAGTACTTGTTAAAAAACTCTAGCATTTGCTCGCGCACGTTAATTCCATCACGTTCAGGGATGTGCTTCAA
ACTCTCAGCATTACCCCAGGTGAAGCAGCGCGAGTACGGGTGTCCCTGAACACTCGTTTCACACATGACTTGCTGCAGACGAACCGGATTGTTGTTTCGT
ACTCGCTGGAATTCCGATTCGACCGCTTTCAGCTCACGATCCATCGCCTCACGTCGCAACAACGGGGCCACGAAAAGATTGGCAAATAGATCAAGTGCCG
TTGCCAAGTAATTGACATCTACATCAAATACGAACCGGGTAGACTCGCACTCCGTCGCTCCGTTGCTGGACCCACCGTGGGCACTGAGGAAAGCTTCAAA
CGCGTCCTCCTCCGGATACTTTACACTGCCCATGAAGATCATGTGTTCCAGGTAGTGCGCCAGTCCCGGCAGTCCTTCGGGGTCAGTTAGACTTCCCACA
TCCACAGTCAGACATGCTGCCGCCAATGGAGGAGCTCGATCGTTGCGTTTTTGGTCATTTTCTTCTTGCTCCTCTGCACTGTCGGAATCTGTGCCGTCAG
TTGAATAGAGACTGTCACGGTGATTGTCATTACCAGCGCAATTAGTAGTCGATAAAGATGCAACCCCAGTACCGCTCTGGATAAGTAGAACCTCCAATCC
ATTGGACAGAGTGACGAGACGATAGCTCTTTTTGTCTGCAGGCGACCGGAATTTGTCCAAACTCACGCGGGACAGCGACGACGCCATCTTCACACCACTC
GTGTGCTGCGTCGCCTAGTAATGCTCGATTCGAGTGTGATATGCAGAGGCAGAAGGTCTCCAATGCACCCAGCATGGTGTCATAAGACCTACCCAACGTC
GTCCTAGCAAACTGAAGTCTGAGAATTGACCACTAAGCTTCGACTATCGAGAAGTTCAGACCAATCACAGTGAAGACGACTGCAACGTACCATTAAACTC
ATTACTGTGCAATAGCTACTACCTACTTGTTGCGTCTTGTTGCTACATTTGCCATATCCATCGTCGTCCTATTCGTCCAGAGACGCCACCACTGCACCGA
TAGCTGCAGTAGATGCACGGTACGTCGTCATAAGCGTCGCCTTTGTTGCAACCAGTGCCGGGCCGCTGAACGCGCGAGCCACGTTCATATACGGACGCAG
CATCTCCTTCGCCGACTGGCCGATTGGCGTACTGGCCACGAACTCCAGCGGCTCCACCACACACGACTCGTAGAAGCGATCGAAAAAGCTGCCACGGTGC
GTCACGAACACATTATTGCGATGTATACGCAGAGCAGCTTCATAGCCCGATTGAGTCGTGTAGCTACAGAGCAGATAGCTACCGCTTGTTTTCTTTACAT
GAAGCTCAAGGTCTTCCACAGGACCGAGTACTGCCGATGGGTAGTAGCCGAAGCCCTCGAATTTGACCACGTCACCCACACGTGGTTCCATCCCGTGCGG
TTCGTATTGCAGCACGACGCGGACTTCACCCAAATTCAAATCTACTTCGGGATGCTTCTTGCCTGTTGGTGCCCCATTTGTGCCAGCCATGGGGAGTGCG
CCACTGAGCGGAATCCACTGATCCATAACGTCTTCCTTTCCCTCAATCAACGGCGTAAAATCCACCACCGCCGTCCCGATGACTGAACCATTGGCCATAC
CCACGGCTTCTGTGGCTTTGCCGGTGAGTGAGTCTTCGTTCATTGCGTCCACGATGAGTTCCAGTCGCACGTCCGAGTGGTCGCCAAGTGGATGGCGCTT
GTGGTCTAGTTTAGGCAGCTTCACTTCGAGGAACTCGCGACGCCACGTGGGATTATCGTTACTGGGGATTGTGGAGCTGCGCACGCTCTGCTTGCCCACG
CGGAAGATCACGTACGGGTTGCACGTGCGCACCCAGAACATGGAAGCGGCGGCGCGCAGGTTGCGGGCGGCCACCAATCGGATGCTGAGAGTCCCGGCCA
CACCGTCCTGGTGGTTCAGGTGCTTCTCGTACAGATAAGCGGCCATGTCAGCGCGCTCCTGCTGCTGCTGCGCCACTAGCGCCATCGTGAGAACAACGTC
GTCTGGCTGATCAGGCCCATTGAGGCTGTCTCTGCAAGGATAAGGCTATATATACAATTTACTGTCGGCATGGTTGCTTCCAAGAACAAGTTTTTGTTCA
GGCTATGCTGTAATATTTTGAAATGCGAAACGTCACCTGACACCGCGCTGTCATATGTACCATACTTGTACCAGTCTCACCTTTAAAAAACTACAGTAAT
GCAGCTCAACTGGTAAATTAAATACATGATAACCTTTATAAATACGTATCGATGAGATCAAAATTTAGCATATTATTTACAGCTAAAACTTATGCTTGCA
TAATACTATTATATTGTACTGTTCAAGCTCAACATTTACGTCTGTATCGACGCCTCGAGGTCCAACCAATTGTTCATCAGTTGATAGCGGCACCACTTCA
TTTTGTCTGCGTAGCTGCTGCATCGGAGCAGCGCGAGGTGAAGCAACTACTAGAGCGACAGCCATGGCGAAGGGTATCAACACGACGAAGGCGTCGGCCG
ACAATCCGAACCGCAAGGTCCCCAAGCGGCAGAAGGCTGCCAACATGCGCGACAAGAGCACCATCAAGCGCCTCAACATGTACCGCAACAGCGGCCCCAT
CCGCAACAAGGCCGGCAAGGTCGTGGGCGGAAGTCTCATGATGAAGAACAAGGCTGGAGGACAGGAGATCACGAGCGCCAGTGGCCGCGTGCAGCCCGAC
CGCCGCTGGTTCGGCAACACGCGCGTGGTGGGCCAGAAGGAGCTGGACAAGTTCCGCAACGAAATGTCCCTCAAGGCTGCTGACCCGTACTCTGTGGTTC
TACGCACGCGTAAACTGCCTATGGGTCTGCTGCAGGAGAGTGAGAAGACGTCGCGCATGAAGCTGTTGGAGACTGAGAGCTACGACGAGGTCTTCAATGG
AAAACGTAGTCGTAAGCGCGCGAAGATCGCTGCCACGGACTACGCTTCGCTGCTCTCCAGGGCGCAGGAGAACGCAGAGAAGTACGAGGCCAAGGGACCT
GATCGTAACATTGCTGTGGAGCAGGAGTTCAAGGAGGAGGTCTCACACGACGTGTTCAACAAGGGCCAGTCCAAGCGCATTTGGGGCGAGCTCTACAAAG
TGCTGGACTGCTCGGACGTTGTCATCCAGGTGCTGGATGCACGCAACGTGCCTGGCACACGTTGTGAGCATGTGGAAAAGCACATTCGCAAGAACGCTTC
GCACAAGCACTTGATCTTTGTCATTAACAAGTGCGACTTGGTGCCCAACTGGGTCACTAAGCGTTGGGTGCAAAAGCTCAGCGAGACGACACCTACACTT
GCGTTCCACGCGTCCATGAGCAACCCGTTCGGCAAGGGCGCACTGATCAATCTGTTGCGCCAGTTCGCTAAACTACATCAGGAGAAGAAGCAGATCTCGG
TGGGACTCATTGGCTACCCGAACGTGGGTAAGAGTTCGGTCATCAACGCGCTGCGTAAGAAGAAGGTGTGCAAGGTGGCTCCTATCCCTGGTGAGACGAA
GGTGTGGCAGTACATTACGCTCATGCGTCGTATCTTCCTGATTGATTGTCCTGGTATCGTGTACGACACGGGTGATGACGAGATTGAAACGGTGCTCAAG
GGTGTTGTCCGTGCCGAACGTCTGCCTCAACCGACGGACTTCATCCTGACCATCCTCCAGCGAGTCAAGAAGGAGTTTATCGTGAAGGTGTACGGAATCG
AGGAGTGGAATGACGAATGGGACTTCTTGGAGAAACTCGCCAACAAGTGCGGCAAGCTGCTGCAGAAGGGTGAGCCTGACTACAACAACGTCGCCGTACA
GATGATCAACGACTACCAGCGCGGTAAGTTGCCGTGGTTCATCGCTCCACCCATGCGTGCCGAGGAACTTGCTGCTCTCGAACAGAAGGGAGATGACGCT
CCGCTCAACGAGGCGGAGGCTGGCGAGGACGAGCAAGTGGAACTGGACGAGGGTGAGGAAGTAGAAGAGGAGGAGGACGACGAGGAAAAGGCTGAGAAGG
ACAATGATAGTCATGAGAACAAGGAGAAGTGATCAGATACGCCATCGTAGCTGCTGCATTTTATTTTTTCTAAACGAAAGTGTTTATAGATGATTGATAC
TCTGCAATTCGCGACAACATAACATTCCTGCGCTGGTCAACGATCCAGCCTACAGTTTGCTGCTAACGATCGTCGTCTTCAACACCTCATAAAAATTAAC
TTCTCTGGAGTTTTCTCTCAATTACAACGATTCGCCGGCTGACAAAACAACTTGTGGCGGTTCTTCCAGTCCTGCTTCTGACATGTCTTGCCGCAATAGA
AGATGCATTTACAGCGCGTGCAGGCGAAGAGTTTTCCGTCCTGGTAGTTGAGTGCTTCACATGCATCATTACCGCAGATTCGTTTACCTGATTCGCGTAC
TTCCAGTGCCTTAACGCAGTCGCCCTTGGCCTCATAGACCTTGGCGATCTCGTCACGCGTGAGGTTTCCGTCCCGCAGCGCGATGTAGATGCCCGCCTTC
TCATCCACACGATCACGCACCTCGAGCGCCTTGTTCAACAGCTCGAGCGCCTCGTCCAGCTCGCCCAACTGCCGCAACACGCCGCCCAATTCATTCTGCG
TCAGCGCCACCGACACTTCATCAAAACCCGCAGCTGGTTTCCGTTCCAAAACATCGCGCAGCATCGTCTCGGCCTCGTGCAGCTTATTGGCCTTCACCAG
CTTCGTAGCCTCATTGCTGCGATCCACCAGCGCCATGTACGCAGCCGCGTCGCCTGACGACATCACCACGTTGATGTGCGTCGCCATGTCAAGGGATCCC
TGCTTATGTCGATACCGTTTGGGTACCAAAATCCTGACTGTAGAAGCCGCAACCCTGCGTCGTTGTCTTGGTTTCACTATAGGGTCAGTCATTTCTTGTC
CGCATTCGAGGAATCAGCGCCGTCGCATTAGTCGACGGACGGCAGAGCACAATCTCACTCGGCGATGGAGGCCAAGCCGCTGTCTCCGCCTCGTAAGAGC
GCGTCGTCCCCTGCCAAGACGACGGGCAAGACGTTGACGCTGGCCGAAGCCGTCGCGCAGCAGAAGAAGCCAGCCAAGCCCTCGCCCATGCAGATCCAGG
TATCAGTCGACGTCCCAGAGCCGCCGCGGTCGCTTCCAGCCATGCGCTCGCCCGCGCAGCCAGTGGCCGAGCCACCTGCGACCACAACCAGTAAGAGCGA
TAAGAAGTGCGGACTCAAGGAGGTCAAGGACGCAGCTCCAACTATCCCCGCTGTACCTGAAGACGACGGCATGACGAAACTCCATCTGACGGACCCGTCG
CGTCTCTCGGACATGACGCAGCGCATGAAGCCGAAGCTCAAGGTGTCGGAGAGCGGTCGCTTCGAGGACCAGTTCTACCATGCACACGACGGCAGCAAGG
CCATGGCCAGACTGCGGAAGCGCGCGTACCAGAAGAAGACTGTGCACATGAGCGGCAATGATGTCGAACAGTTCTCGGACGCAGACATTATTACTAGTGG
TTATCTCGTGAAACAGGGCTCGTTCTGGAAGTCATGGAGACGTCGCTTCTTCATTCTGAGACGAGACCGTCCTGTGCTGTGCTACTACACGTCAGCGGAG
GAACTGGCTAAGCTCGGAGAAATTGCTATTGATGAAAACACACGTGTGCAACCAACGCCCAAAGATGGATTCCCATTTAGGTTTACTATTGAGAACGAGG
GACGCAAGTTGACGCTGTTCGCGGAGCAGGGAGAGGAGAGTATGGAGGCATGGATCTCGTGCATTAACGGATGCATCACGCAGCGTGCACGGTCGACGTC
TCGCGCCTCAGTAAATGGATCATTCACTCGACGATCGGAAGGAGGATCATTCCGTACTCAGCTACAAGGGCGTACCTCCGAGAGCACTCCTATGCTGGAC
GATCTCAATGTGGACCGAACTAGTTTTTCACGCATGGAGAGTCCGCATATAGCGAGCGGCATGAACGCCATGAAACGTTTCTCGACAGACTCAACTGTCA
TTCAGCAAGCTGCTAACGACTCCAGATCCGTCCGAGAGAACGAAGAAAAGCAAAAACAGCAGCTACAGCAGTCAAGGCAACACCGGAACTCCCGTGTGAC
CACCGTAGTATCCACCCCTGCTGACGAAGCAAAACCAAAACGTCGACTTTTCCGCTCATCCAGTGCAGGTTCCATTCTGACTCAGTCCGCATCGTTCTCC
GTTGCACCTCGTGCGTACGACGACAATGGACTGTCGATGATGCATTCACCCTCTCATTCAGCAAGTGATCTGCAAGCGGTGCAAGCCCCGTCGAATTCTC
CGCGCGCGCCTAGCCTCAGCTTGCCAGGATTTAAGCCTCCTCCAAGTGTGCAATTAGCTGTATCTGTTGGTAGCAAGGCTGTGCAAGATGTCCCACATAT
GCTGGTGGTTTTGTTCAGTATTCGCCAGGGACAACTACCTGAGGAAATCTCTCGCACGGAAATGCGGAGCTCGCTCTCGCTTCGATCTTGTGGTGGCGAT
TTTTATGCTCGAGATTTCAATGCCTTGCTCTTAGTGCCGCGTACTGCACGCTCGATGCTACAGTTTGAAGTCTTTTCGGTGGTGAACCCAGCGTCGGAGT
CACTTGAGCATCAAAAGTCGCTTGGTTTTGTACGCGTTTCTTCTTTAGATGTCCTTTTCTCGCGGGAATCATCGATGCTGTTGGAATGCCACCGAACGGA
TTCGTCCAAGCAGCTTTACTACCTTGTTGTGGATCGGTTCCTTCCACCTAGTCACAGTATTAATGTGAGCCACGCATACACCTATGCAAAACACCATTTC
CTGGTGGACACACAGTCAATGGAAAAGCGAAAGTCAGGTGATCTCATGTCTAGCTCTACTATGAGCTTGCGGGGTGGATTGAGCTACAACGAGATGCTTC
GTGGTCAGATGAACTCGTTGACAGCCAACCACGTTCTTGTTTCAGAGGAGTTATCGACGTCTTATGTCTCAGTTTCGATGACTGTCGCTTTTCTGAAGTA
CCTTCAGCGGCGAAATGTCACCCGCATAGATGAAGCTAAGCAAGTTATTAACGACATGAGGCAGCACATTCAAGCTAGTAGCACAGGTTTGAATTCGTCT
AGCAATCGCGTTCAAGATGTGGAATATCGGATGCGGGACGTGGAACTTGAAATGGCTCATTATATGCGCCTCCACGCTTCTTATCAAGAGAACCTCAAAC
GATACGAAACCATGTTCGCGTCACTTGAGAATGGACGTGAACAGGGCATCACAGGGTGTCTGAAGCGTAGTAATATGAAGAAGGATAAGGCAACCGCCTT
CATGGCTACTAATCTGAACTGCCATCTTGTGCGTGGAAGACGTGTGCGTCTCGCTGGCGATGTTGACCGATGTGAGCAAGATCGAAGAGGCAGCTTAACA
TCTACATCAATGGAAGATACGTCTGCTTCTGATGAAAGTGACAGCGAGACATCGCCTACATCTGAGTTTGTGTACTCAGTAGTCACTCATGGCTGTGCTG
CAGCACATATAATGGGTTTCAAGGAGGGTGGATTGCGACGCCTTCAGCAACAGCTGGCTTCACAAAGTCCGTCAGACCCACGTCTGCGTGAGCGTATCGA
AATGAGAGAAGACGTGGTGCGCTCGCAAGTGCTAGCAATTGCTGGTGCTTCATTCCTCAACGCGGTTGGCCTAGCAGCGACTCGAGGGGGCCAACATCGT
CAACGTTTGCAGTTAGCCTGTTCAACAGGGTACCTACTCAGTATTGAATCGCTATTGAGCACGGTTGGTGCCGAAAAGGGAATGCTGGAGGATATGTCGG
AGGGTGTTCGGTGGCTTAACAGTGTGGTGAGCTTCCAGCTCGTACAGTCTGGAGAAGCTAATCCTCACATGGAGATGTCCAAGTGCGTTAGCGTGACCAG
TACACCAACCGGAGATCATGTGGTGGTTGCGTTCGCTGTACCACCTGATGTCTTCTCAAAACTCCCGGAAGTGCTGCAGCAAGGCCATGCCATCAAGCTC
CACGGAGTGATGTTTACTCAAGGTATTAACGAGATGCAGTCAGTGGCTAATCACTATCTGAATTCTAGCCTACAAGATGAGCTGAATTTCGAGAGCGTGC
AGATGTTGCAGCGGTATTTCCGAGTGTACCAGACACAAGTGACGGCTAGTGCTGGCAGCGACGATAAGAAGCGCGAAGCCGATATAACCGAGCTGACTGA
GCTACAATCAGAAATCGAAGCACTCACTGGTCGTCTCAACGTTCGCACCGAGAATGTGCAGAAGAAGTTGGTGAACATTCTTATTGCATCTAGTGATATT
TGCCGCCGTCTAGGAGCAGGACGCACAACGTGCTGCAAGAGTGGAAAGGACCGCACAGCAATGTCGGTGACACTGGAGACATCTCGTTTGCTGGTGGACC
ATTTCCACGTGAAGCAGGGTGTGCATCTCTGCAACGCCATGAGGGAACGGGGTGTTCGCCGCATCAACGTACTAGCGAACACTGGCAAAACCAAGTTCGC
ATTTAACTCGTTCCAGCTCAAGTATATTCCTGACTGCTACAAGCCACCACTTGCTTGCGCAGACTCGCATGTAGCCTCTTAGCAAGAATTACCGGTGAAA
AACATGCAAGTTCGAGGTAGGTCTGTCGTGTTCATAATAGCCTCTTGTGATTTGAGTTCGTTGTACACTGTAGGATCGAAGTGTCAATCCCACAATGGAT
CGTTCATCATTTTGAGCTCCTTCTCTCGTTTTCGGCTGCGCTGTAGTTTCTGGACCTGCATCGCATCATTACATCACAGATCAGTAGTGCCTTGCACAAA
GGTTAACACTTTACCATGTGCATACCGCGAATCGAAGTTTCTGTTCGTGGCTGCGGTTGCTCTCCTCCAGCTCTTCGATCTTTGCTTGGAGAGATGCTAC
CTGTGGATTGCAATGCAAGGCTTCGTGGAGCTGTTCCTCAAGTTTGCAGATCCGTTCGCGGTATTTTTGACGAAGTTCG