Description :
From Genome Similarity Track
Location :
Scaffold_113:44457- 46106
Sequence
1649 bases(100 bases per row)
ATTTCCTCTAGCGCAAGGTGCTGTGTGACCCAGTCACACTTGGTAGCACTAGTAGTTAATCCACGCCACCGCGAGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGC
CTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGCCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTC
CGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGAAAGAACCTTCACTTCTGGGTCCGAGA
AGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTGTAC
ACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGC
GTTCGCGCTTCCTCGCGTGTAAACAAGGGAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGAAACCCACTCAAC
GAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGAATGCAGTTAAGCACCCTTGAAGAGGCGATTC
AAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGATCTCAGCATGGACTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAA
CGGACCAGTTCCCATGGAGCTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAA
AGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATTCCGGGGACAGGGGGACGCTGGGAACCAGTAGGGGCGGG
GCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGAGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCAATCTCGAATCGGCG
AAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATATGATCATCCCTTTAGAATTTTGATCGATTCTGGGGCGTCGAAGAATTTCGCAC
GCCACCAGACGGTTGCTCGTAGCAGCAACAAGCTGTCCGATGCTTTGAGAGAAAGAAAGGACAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGT
CGTCACTGTCCCCAATGTCCAAGTGGATCTGGTCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATG
ATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGTCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGG
TGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCCG