Description :
From Genome Similarity Track
Location :
Scaffold_775:44457- 45794
Sequence
1337 bases(100 bases per row)
CCTCGACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAG
TACCAACCGAGTGTTCGGTCGACTGTTAAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGT
TCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCA
TGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTTCGCCGAGTG
TTCGTTTCCACTTGGTTGAAGTACAGCAGCTTTTTCGAGTCGACTCAGGGCCTCATTATGCTTTTTGGCCCTTCGCTCCTTTTCTACAGCCTGATAATCT
TTGGCCATAGTGAGGGCGACCTCTTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCTCAA
CGTCGACTGAGCATCCATACCGTGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCCGCGATT
TCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGAACCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGAT
AGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATTAATGATGG
GGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTGAGCGAG
CACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGTGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTAAGT
TGCCAGGTGAGTATCCACGAAGCTGTGGACGGCTTTTATTCGAGCTGCAATCTGGACATGACTTCACATACTTCTCCACGTCAGCGTACAAGCCGATCCA
ATAATAATCGGACTTAACGCGTTGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAATTCTGCAAGACCTCTTGAATCATCGTT
GTTGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCC