Description :
From Genome Similarity Track
Location :
Scaffold_22:444553- 449687
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008438Similar to Rai14: Ankycorbin (Mus musculus)
Pytul_DAOMBR144PYU1_G008437Protein of unknown function

Sequence
5134 bases(100 bases per row)
AGGATCTCGAAAGCCGAGTTTCTCAACCTCTTTGCACGGGTGTACGCACCGGCGTACAAATTTGGTCAGGAGCTCCGACTCGCGTGTGGTCGCGGCCATG
TTGACAAAGTGTGCGAGTGGATCAGTCGAGGCTGCGACTTGAACGCGAAAGACGGCTCCGGGTGGTCGGCGCTGCACTACGCAGCAGACTTTGGACACTT
GGACGTCGTGCAGATACTCTTGGAATGCGTAATGACGCCTGAAGTGCCACCAACTTCAGTTTCAAATTCCTCAGTCCACCACCTAGCGGATGTGAATTCG
CGCGACGCATGCGGGTGGACGCCGTTGATGTGCGCTGCCGCGAATGGACACACAGAGATCGTCGAGGTGCTGATCAGTGGCGGTGCCGATCCATCACTCC
CGAGCGTCGAGGGTCGGACAGCACTGCACTGGGCTGGGTCACGAGGCATGGACGAGACCGTGAGTGCGTTGTTGAAGGCCGGCGCGCCAATCGACCTCGT
CGATCGTAGTGGTTGGTCCGCGCTCCACTGCGCGATGCTTCATGGAAGCGCCCAATGCGCGACGCTGCTGGAGCAGGGCGCGGCCAGGGAGCTCAAGGAT
AAACTGCACTATCCACCAACGTACTACGGCGCTGCGGCCCCAAACATGCACGAACCACTTTAGTGCAACCGTCCTCAAAGTGTACAATAGGCTCTCGAAT
ACAGCGACTCTGATGGAGCCATGCTGCCGCTCATGCAACGCATCATGAGATCACAGAGATGCCACTTGCTGGAGAGCGTCGCGGCTGTGGCGTACGGTGG
GCGCGCCTACAATAATGCGCTCTGATGTGTGTGCCCTCCCCCTCTCCCCCCTTACACCCGCAATCACTGTGGGTATAACGCAGAAAGAAGCGAAGTGCCA
GCGGGGCCAATTGTGGCACAATGTGTGCACAATGGCCGGTACTTCTTTGCTGCGTCCTGTCTGGTTGGTGCTGTACAGTGGCCTGTGGTCGTTGGACTCT
TTGTCCGCCGCCGCCGCCGCGGTGGAAACAAAAACACCAGCGTGGATACGCCGTCAGAAATAGGATATGTCGGGATTTGGCGGGCGACGCTCTTGGTTTC
ACAAATCCTGCACATCTTGTGACAGTACAGCCCCTCAAGCACCATTTTATCCTTTCATATCAGGTATTTGCATATTTGACTCTCTATATAGTGGAATATG
TTTGTTGTTGCAAGATCAGTATGAGTATTCTTCATATAGAGGCAAATTAAAATCAGTCCTACGTTACTGGAGCTGACGATTTTGCCGATAGGTACAGACA
TCACCAAAACAGTGTCGACTTTATCATTAAATCTACACTATTCACTGAATAGTAATAGTATTCAGTACCTTCCGTGCACATTATGCTTCAGTTTATAAGT
CGACATGACCTGATGATACGCTGCCGTGTCCACCATCACACACAATGATCACGTGGGACAACCCGAGCTGTTGTTACAAGCAGCCTGGGCCCGTGATTAT
GCGGACCTGAGTTGCCTCGGGTGTCATGTCCACACTAGGAGTCATCCTGTGCCGCTACTTTGCGCCCACCAAGCACATCACGTGATGGCGAGTCCCCAGT
TGCACACCCATGGACGCACGGTTTCAGCAGCTTCGAATGCGGCCTTAGTCGAGCAGCTCATTTGCGATCTTGCACTCGAGAAGCCATTCCTCTCTCGTGC
GCGCCAATAGATCAGTTCAGCCGCTATCATGAAGCCATTCATTGAGCCGTTAACTCCGTCCCTGCCTGGACACGACGACGAAAAGGCACAGCAAGTCGAT
CAGCAACCACTTGACCAGCACAAGCGCAAGTCGTGGCTGCGCGCGCTCATCCTTGGCGGCGTCGCCTTGGCTGCAGTTGTCGGCATAACTGTGGTTGCGA
CCTCCGAAAGCTCCAGCTCGTCGTCAAGCTCCAGCATTTCGACGTCGGCGAGTGCGACTACCACAACGACGGCCACGACTGCCGCGACGAGCGGCGTGCT
CGAGACATTCACGGTCGCCACACCGTCGGGGACACTCACGCTGCAGAACCGCGATATCGTCGAGGTGAGCTTCAAGGTGCAAGACGGTCTCAGCGTCTCC
AGCGGCGCGCGCAACAACTGGGTCGGCGTGTACTGCATCGCGAACGAGTCGGACGCGGCAACGTTCGCTACGAGCGACTACATCGACTACCAGTACACGT
ACAATGCGACGTCGGGCACCTTGAGCTTCGGTCCGATCATCAACATGCGCTGCGCGTGGCAGTTCCGCTTCGTCACGCAGGACAACACCGTGCTCGCGAC
GTCGGAGCTGCTGCACATGGAGAATGGAGACAAGGAGCCGCTGCACGTCCACCTCGCGATGACGAGCACGGCGACCGAGATGCGCGTCGGCTGGACCAGC
GTCAAGGTCGACTATCCGGTCGTGCAATACGGCGCCGACAAGACCAACCTCACCAAGTCGGCGGTCGCAAACGCCACGACGTACGCCGCCTCCGACATGT
GTGGCTGGACGGCGTCGACTGTCGGCGCCACGACGTTCCGCGACCCAGGCTACATGTTTGACGCGCTTATGACCGACCTGGTGCCTGGCGTCTCGTACTA
CTACCGCGTGGGCGAGGTCGATGGCGAATGGAGCGACGTGTACTCGTTTGTCGTTCCGCCGCAGGCTGGCATGTCACTGGGGAACGGCAAGAGCACGAGC
TTCTTTGTGTTTGGTGACCTGGCCGCGACGGCGTCAGCGACCAGCGAGTACGAGGTCGCCAAGAGCTGTGGCACGACGATGAAGCTCATCGAGCAGGACA
TCCTGGGCGGCGCGCACAACTACGTCGCGGTCATGCATGACGGCGACCTGTCGTACGCAAAAGGCTCGACGTACCTCTGGGACCAGTTCGGGTTTCTCAT
CCAGCGCGTGGCCTCCAAGGTGGCGTACATGGTGAGCATCGGCAACCACGACTACGGCTGGGGCGAAGGCTACGCGATCAACGCGACCAAGTACCCCGCC
AACCCGCTGCTCGAGGGTTCCGGTGAGACCGGCATTCAAGCGAACGGCGAGTGCGGCGTGCCGACGCTCAAGCGCTTCCACATGCCCGACAACGGCAACG
AGGCGTTCTGGTACAGCATGGACACAGGGCTCGCGCACCACAGCGTCATCACGGCCGAGATGGACTTCTCGGTCAACTCGTCCATGTACAACTGGCTGGC
CAAGGACCTCGCGGCTGTGGACCGCACCAAGACCCCGTGGTTGTTTGTCCACATCCACCGCCCGATGTACTGCTCGGCCAACTACCCGCAAGACTACAAC
ATCACGCTGCAGATCCGCGCACAAATGGAGTCGCTGGCCGTGCAGTACAACGTGAACGTCGTGTTCTCGGGCCACTACCATTCCTACGAGCGTACGTGCG
CAGTCATCGACGGCACGTGCGTGGAGGCAGACGCCACGACGGGCGAGACGAATGCGCCGATCCACATCATGGTGGGCTCCGGCGGCGCCTACGTCGACAG
CTCGACGTGGATGGACGTCTCGTGGAGCGAAGCGCGTCTTCAAGCGTACGGCTACGGCCGCATGCACATCCACAACGCGAGCTACGCGAACTTTGAGTTT
GTGCGCAACTCGGATGGCCAAGTCACCGACTCAGTGTGGATCCAAGCGAGTGCGTCGGGGTCTGGCGCCAACGGCCGCATCTCCACGGACGGCTCGGCGC
TTGTGTCGGCGAGCAGTGGCGGATCGGGTCTCGGCACAGCGTACATCGTGGTGATCGTCGTGTGCTCGGTCGTGCTCTTTGCCGTGAGCGCGTACCTGGT
CACGCGCATATGGCGGAAGAAGTCGACGAAGATGAAGAGCGTGACGCCCAAGCCGTTCCACCGGATGGAGGACGAAGTGGTGTGAGCTACTGAGGAACAT
GCCGACAGCAGGCAGATATGAAATAGTTAGTACAAGTTAGCGTGTAATATAATGCCAATAGGACGCACACAATCACATACCGATCGCATCTTTATCGTCT
CAGATAAACTAAATGCACCCGCCTATGTTTCATACACAAAGGCGACTAACACCGCATTCAGTATCTACAGCATGTCTTCACCTCAACTCAAGTACGAGTC
TCGAGCCCAATCGGGAGCCGCAAGTGACGCCACTTTCGCTTGGAACTCGTCGTCATTGAGCCGCTCGTTAATGTTCGTCACAAACTCGTAGCTCGAGAAC
ACGGGGCCGCTGTACATCACATTATCCACGACGAAGAAGCCAAAGTGCACGTCGCCGACGCCGAGATGCAAGATTCCTCCAGGATCGTTGTGCTCCACGG
ATGGCACGTCAGTGTGCACATCGACGACGAGCACATCTCGCTTGCCAGAGTCTTCACGATTGGTGTAGAACAACCTCGGATACCAGCCCAGGTACCTGGA
TCCGCCGCTGCCAAAGCGCTCTTCCATGACGGTCTTGATAAAATCTGTCTGCTCCTCGTTCAGTGGCTGCTTCTGGACTTGACAATCAGCGATCTCCTTG
AGCGTTTGCATCGTCGCCGCGAAATCTGAGAAAAAGTGGAGACCGTTGTACTTTATGCCAGAATCCTCCGAGGGTGTCGCCAGGTTTTGAACAATCTGAG
CCATGCGAGTCGCTAGTTGCTGCATGGTGGCGTAGAATTGCGGATACGGATCCACGAAACCAGCGGCGTATTCGCATCGGGTACCCATTGTGTAGCTCTG
CTTCGCGTACAAGACCGAATCGTGGCGAAGCTGTGTGAATGATGCGAGTTGCGTATTCATCTGGCGCAATTGCCACTCGTGCGAGTGAAACACTCGCGCA
GCACTCGCTGATCGCGCGGAAAGTGCTCGCAATGCCCGAATCCACAATGTACTGATGCTATCGTCCTTCGAAGTGTCCGCAGCAAACACGTCATCAATGG
TTGCACGAAGCGCGAGAAGATTGGACGCGTACGGAACTCCATCACGGAATGGCACAAACGCCGTTGCTTCTCCTCCCGCTGTGCCGCTCATTCGCTGAGC
AGCCACCGACCCCGCTGCATCGTTCCCAAGTAGCGAAAATGCAACGTCAACAGCGCTCGGTAGTCGGCGCACCACCTTGGTTCGCTCGTGGACGACTTGA
TCGTATACGAGCCGTGAAAAGATGAACGAGCTCC