Description :
From Genome Similarity Track
Location :
Scaffold_68:4445- 6626
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_68-fgenesh-gene-0.9NUC156 family protein

Sequence
2181 bases(100 bases per row)
AGACAGCGACGCGTGCACCAAGCTCTATCGAGATAGCAAGCAGCACCAGGTCTGCGCCATTAGTATATAAAACACAGGATCTATATAGTTCGTCAATGCA
AAATACAAATCTATTCAATCTTCTATCACTTGCCACCACCGCTGCTCTTGTCGTCCCGCTTGCGCTTGATGTTGTTGCGGCTCTGCATCGCTGCGGCACC
TGTGCCCTCAGCCGTGAGCACGTCCGTGACCACGTACGGTGCCTGCACCGGGTCGTTCACGTCCACGACGAGCGATGCCAGCGGGAAGTTGCCGCGCACC
AGCAGGTTCACGCGCTCGATCACTCGAAGGGGCAGTGGGCTGAGGATGAAGAGCAGGCGCCTCTGGACGTCGACCGCGCGGATCAAGCCCACGCCCAGAC
ACGGAGCATGCGCCGGCTTTACCAGTATCCGAGGTGGTCCCGCACGAGCTTCTGAGACTGGCTGTGGTGGTGGTAAACCTGCTGAGCCTTCGTCTACTTC
ACTATCGAGCTGCTCTTCTTCCGTATCCTCTGACGGCGGTGGAGGTGGCAATTCTCCTGAGCCTTCATCTTGTTCGTAGTCAGCATGGCGCTGTTCTTCA
GTTGATTTTGCAACAGGAGGACGTTTTGGGTTGATGCACAGCCCGACGATGCTGCCGTTGAGCGAGTAGAGCAGCTGGCTCGACGGCACGGAGCTCCCAG
CAAAGCCAATGTCCACTTGATCGAATGACACGGCAAACGGCGTCACACCGGCGTACGCGCGCGCAATGTGATCGTCCACGCGGTTCTTCTCCGAGAGCAC
GTGTAGGTTCTGCAGCTGCGGCCGCGCGAGGTCGCACGCGCTCTGCGACAGAAAGTACTGGTGCCAGCGGTACAGCCGCATATCCTTCGAGGACCGCGGC
GGCTGCGTCACGCCCACGGGATCCCAGGGCTCCACGCCATGGATCTTCCACTTGCCGCTTGATGGGACCGTGAACTGCTTACTCTTGGTCGTCGCGAGGA
GCTGCACGACGTGGTCTGGGTTAGCCTCCTGGATCACGGAACAGAGCAGGTCGTGGCCCATGCTCTTGATCCACCCGTCCGTGTTGATCACCAGCGGCAC
GTGCGGTTTCTTGTTGCTGTTGCTTCCTGCGTGGATGCCCCACTTGGCTTCGTAGAGCCGCAGCAAACTCTTCACCGCCTGCATGTAGTAGAGAGGGTCG
TTGCTCGGGTTCGTGCCACCGCAGAAAAACGAGCGCAGGGGCATCTTCATGTGCGTGAAGCCCGGTCCCAGCACGGGCGACACGAGCGCATGCAGCGACA
CAAGGCCCGGCGGCGTGAGCTCCGACTGGCCCAGGTCCGTGTCCAGGAATGCGACCATCCCGTAGTGCGACAGCAGGCGGTTCACGAGGTACCGGCAGAA
CGTGGACTTGCCTACGCCCTTGGCGCCGCACACGATGATGCTCTGCATTGGGTTGCCCGTGGTCAGCAGACTCGTCTCGATCGTGTCTACCGTCGACTTC
CAGGGCCGTGTGATCTTGATCGTCCGGAACGAGTCCACGTATGTGAGCTCCGAGAGCACGCGCCCCGGAGTCTTCCAGTCGTGGTATTGCAACTCGCTCG
GGTTGGACGGCACGACCGAGTCATCCGCGTCACCAGTTGCCGCTTTGAGGTCCAGCTGGTCCTCCTTGGGCACGATGATCTTGAAACCTGGGAGCACCAA
AGTGTTCGCGTCCTTCTCAGCCGAACGGTTACTCTCGTAGAAGCACGTGACGTTGCCATACGTCACGGGGATCGCGCAAAAGATCAGCACAATGGGAAAG
TCCTCGGCCATCTCTTCCGCGAGCGCATCAGCCGCGTGCTCGTCGTCCATCTCCACGGGTCGCACACGCACCACCGAGGGTTCCGAGAGCGCCAGCAGCG
TCTTGTTCGCATCGCGGAACGGCGCCTGGTACGCGGCGTCCAGCAGCTGCTTGGTGACTTCCGAGCGCGTGTTCTCGTTTGTGCGGCCCTCAATCACCAT
GAGGTTGTTCCACTTGGGCGAGTAGAGCGAGTAGTACGTCCCCAGTGCCGGCTGGAAACCCAGTAGCTCCACGTGGCCCTGGAACACGCGGAAGAGCGCC
ATGCCGGCGCAGTTGATGCGCGCGTCCACCTGCATGCCCAGCACCACCACGTCGCCCGAGCGCACGCACGACGCGCGGAAC