Description :
From Genome Similarity Track
Location :
Scaffold_46:444496- 454333
Transcript NameFunction/comments
Physo_136571hypothetical protein
Physo_136572hypothetical protein
Physo_157453EMP/nonaspanin domain family protein

Sequence
9837 bases(100 bases per row)
GCCTTGGCTGTAGTGCCAAGCGGGAAGGGCAGCCCTTGAGAAGAGGTCGTCAAAGTCCCTGAACGAGATTGGGCGTCATCTTCGACTATTGCAGACGGCA
ATTCCAGCAATAAACTTGTTTCGTGCCCCACCCATCGGACAATGTACTCGCCGTTGCGCTTTCGGTTGAGGTCGCCTTGCAAGCGCCGTGTTGCTGCATA
GTGATGGCTATGGCCCGAGTTGGGTCCGTTCTTGTGAGCTGAGCCATCGCCATCGCGTAGTTTCTTCTCCAAGTTTGCGAGTCGCTGGTGGCAATTCAGC
TGTCCGAGAGAGTGCTTGTGCCATTCGTACAGCGTCAGAGCCTTCGTGAAGCAATTGTGTGCACCTCGTAAATTGCCGTTCCTAGAGTGAATCATTCCGA
TCGCGCTTAAAGATGCAGCTTGGCCGATCTTGTTCCCCACCGTCTTGTACAGAATGAGCGCCGTACCGAATTGGGCTTTAGCCTCGTCAAACTTGGTCTC
GGTTGTGAGTAGAACACCCATCAACTTGCGGATGTTCGCCTGACAAAGAGGATTCTTGTGCTGCTTTGCGATGTGAAGAGCCTTATTCGCTGCATTCCAA
GCACCTCGGTGGCGCCCCGACAAGAACAGAGAATGCGCCAGGTAGCACGCTACGTCCATCACATATCCGGCGATCTTCTCCCGTAGGTTGATAACCTCGC
CATTAACATTCTCTGCAGTCGAACCAGCGTCTAAAGACGTTCTTGTCGGCCTGGGCGACGATACTTTGCTTTCTGTTTGCCACTCTTCAATAATGCGCAT
ATGGAGATCCAGGATCATCCACAGGTTCGACTCGTGCAAATCCAAGATCAAGTAGGCAGCACTGGATTGAATTGTCAGTGTGCAAATGTGCTGAAAGACC
CAGTAGCTGACTTTCCGGAAGTGCCTTGAGGTATTGTAGAGGAACAAGTCTCGATCAGCAACACAGAGAGACTCCAAAACTTCGTTCTTTGCACCATCGC
CGTCGTACATGCCAAGCAAACTGCGAGCGTAACTTGCGATAAACGGGAAAGTCGAATATGAAACGCATACGGCCATAATCTCTGCTTGGTCATCCATACG
TTCAACATGTTCCGAAACTCGAGACGCCCGTCCACTACGCGTAAGCGAGTTGAGCATGTTTCGGTCGTTCAACACACGACGAGATCCGCCCCTGCCATTA
GGGATTTCGTATTCCACGCTCTCAGCTTTGCCAGACGCTTCGGTGGCATTGCTAATGAAGTCGCTATACGACTTCAATGCTGCCAGCAAAGATTGATCAT
ACCCACGACTAGAAGCATGGCGAGACCTGGAGCTCCGCCTAGAGCTACTGCTGCTGCCTCCCAGAGCGCTGCTTCCTGTGGTACTGCTGCGTTTAGGCAG
ACCTCGTTTCGCAAGTGCAAAACCTGGGATACGATTTCGCTGTATAAGTGAGAATCGTAGCAGCGTCTCCACCAGGCCTTCCCAGTTACTTCCCCACAAA
CTCTTGAAATCAGCTGGCATGGCCCCCGCGGGTAATAATCCAAGAAGAGCAAAAAATCTGATTGCATCTTGTCCATGGTGCATCCGGACTTGCTCCAAAG
AAACATCCAGCGAAGCCACGAGGGTGTTGAGTGCGCTTCGGTCGTGTGCAGCTAGACCCACGACTTGCAGTTCATTTACACCACGACTAAGCACAGCGCG
TGTAAGCTCAGACAGGGATCGGTCTTGAAGTAACGGCGCACACAAAGAGATCGCTTGGGGATGACCATCAAGGAACGCCATTAATGGATGAGCAACCAAT
GCCTCCAAAATCGACGTGGACATTGACTTTGTCCCGCTGGTATCAATATCACCAATTTCTGACACAAGCAGAGCACGCGGTGACTTCTTGATGAACAGAT
CTGCTGCGTGGTAGTGCGACAACCGATTGAGCGACACAACCTTCTCATCAAACCAATTGATGCCGCCACCCATTGCTTGCCGCGCAGTCATCAAAAACGA
CAACGACGGCGTATTTTGCAGCAATTGCAGGAGAAAGTCGCGCGTTGACGTCGGATTCGCATTGACCGGGTCTTCCATGTTGTCCATGACCAGAAGAACC
TTTCTATCGGCAAGCGTTTGGTCCAGTGGCATGTCTTTTTCACGACCACCTTCAGGGAACAAAGCACTCTTGATAGCCGACTCCATTCCTTCCAGCGACT
GGACGCCACGCAAACGAATAAAAGCAACTCCATCTGGAAATGCGTTGCGGTCAGCCAGGAAATGAGCCAACTTAATCGATAGCGTACTTTTGCCAATTCC
AGGAGGTCCCCGCAGCGTCACGAGTCGCCGCGTGTTAACAAGCTCTGCCAGCATGTGCAGCTCCTGCTCTCTGCCCACGAACGACTCTGACACAGCAGGG
AGGGTCTTGCTAAACTTGTTGAACGGACTTACGTCTACCCACTTGCCCACCGATATGTCGGAAAACACGAACTGCTGCGTAGAAGCACTGCAGCTACAGC
TCTTCTCCACGAAATTCACTTCAATCGCCCGCGGCGTTTCCCCACCGAACCAGAGTGGACACGTTTCAGCGTGAAGTTGAGATGATTCCAGCAACACGAA
TTTATCACCTTCGCCATCAGGGATCCGCATCTCCGCGCTCACACGAACACGCGCAATCTCAAATGCCTGTTGAACTGTTTTCCCTGTGAGAGCTGCATGG
TAAAACGAGTACGAAAACATGGCGGACGACTCGTCAAGTACTCGACCTTCTGATCGCACGCACACGACGTGGGCTACCCCAGCTTGAATGAAGACTTCAC
CGATATCCCTTGAATCACAGGATGACACAAATACCAGCTTGAGCGTACTATTCGTGCTCCGAGACGACAAAACTTGAGATAGTGTTCGTAACGGCAAACT
CAGCTCACTCGCTGGCGGTACGCCGTCCTCCGCAACTTCTACCGAGATACTGTTCTCGCTGCTACTGACCTCCTCAACGACAGAAGGACTCGTGCCAGTG
CTCAATATATTCCGCAAGGTAGCCGAGTCCACCAAATGCGCTAGGCCAGAACATTGCGTGTCTTCGAACATGAGATACCGGCTTTGGCCAACGATGCGGC
CGCCGTGCCCACTGAAGTGCAGCACGGTAACCCCACGATCCAGAACTTTGCGAAGTGCGTCCACCGTCGCGACCGCCCGCATCGTGTGCACTGCGCGCTG
GCATTCCTGGAAAATCTTGTTCAGGTGGCTTTGCTCCTGTGCAATATTAAGCGGCGGCACAGGTTTCAGGCGGTGATTGCTGTCGCTCATCACGAACGGC
AGCGAGTAGAGCGTGGCGAGGTCCACCCACGTGTTGTGGATCCCGTAGACGCTGGAGGTCTCGGTGATTGTCGTGCAATCGGACAGCGTGTCGCTCTTGT
CCTCACTATTGCTGGTTGTTGCTGCGCCTCGATTGGGCTGCTCCACGCCGTCGATCATGCGCCGAGCGATGCGCTCGTTCACGGCCTCGTACATCTTCTC
CTCGGCCTCAGTCGTCGTCGTGGCTTCGCGGTTCTCATGCTTCCTGCCTTCCCCATCGACTTCTCCATTGCCTGCAGCTACTTCAGCAGCTGGGGCGGCT
GGAGACTCGTCGGTTCCGTTGGCCTCGCGCCTCCTGGCCAACAAATCGTGTGCCTGCTGCTGGATCCGCTCTAATTGCGTCTCTGCGGACTGCGCGGGCG
TCGCGGGGGGCTCCGCCAAGGACTCCACGAACGCCCACAGCGCATGCTCAATAGACGACAAAGACGCGGCCGCGGAACTCATTGTGACCGCCCAGCAGCG
CGGCGGCGATGACACGCGTGAGCTCTTGGTCTTGTTGGGGAGTGTGGTCAATCAACGTGAGCTAACTACAATCATTCCGAAATATCCATTTACACAGGTT
TGGCCTGCTACATGGCTACATGTCCATTTTCGTTGGCCGTCATCAACATGACCGACGTGAACGACTCCGGCGACGGTCTGTGGGGCCGACCCGACGACAG
CGACTTCACGTATGTGGTCAAGGTACCTGGTACCAATGAGGAGGTGTCGCTGACTGCGGTGCAGGACCGCGAGATCTGCGCTGGCACGCCGGCGTTCCCG
TCGCACGGTCACTGCGTGTGGGACGCCGCCCTGCTGCTGGCGGACTATCTGCAGACCGAGGCGGGCGAGGATGGCCAAGCCACGTGCAAGTTCCAGTTCA
AAGGAAAGAAGGTGGTGGAGCTCGGCGCGGGTGTCGGGCTGGTCGGCATGGCGCTCGCTGTGCTCGGAGCAGAGGTCGTGGTCACCGATCAGGAGTACGC
GCTGCCTCTGCTGGCCAAGAACGTGGACGTGAATTTCGGCGATCGAAGTGGCGTTATTGCGCCGATGACGGAGGAGTGTCAATGGGGAGAGCCATTTAAG
ACGTGCAGTCGTCTAGCGTCGTGGAAGAAGAGTGTCGACGTGGTGGTCTTCTCGGATGTGCTTTACCACGCTTCGGCGTTCCTGTTGCTGATCGAGACGC
TGCACGAGCTGGTGTCGCCAACGTCCGACGTGTTCTTTAGCTTTGAGACTCGAAATGAGTCGATCGAAGCCAACTTCTTACAGCAGCTTGGCAATACGTT
CGACGTGGAAGAGGTTTCAGGCGAAGATAGCCCGCAGGTTTTCGCTAGCTTCGAGTACCCCGACGAGCTTTTCATCTATCATGCGCGCCTCAAGGCTGGA
AGCAATGATAAGTAGCGTTTATTTTTCACAAATTGTACTGCGTCACAGCCTCGCCATGGTGGCAGAAGGCACCTCTTTGTTTCCATTTTTTGCTGATGGG
ATCTCTTCGACGCGGCTGGGAAGAATCCGAGCTTCGAGAGGCACTTCCTTGGTTTTCTGGTACACATTGTCGAGGAAGGCACAGACAGCATCGTTGTGCG
CTAATGCGCGAGGAGACAGCAGGAAGTTGAACATGTGACTGGCGTACGGCACCTTGACGAAGATATCTTGGACGCCCCCGAGCTGCTTAGCCTGATACGA
TGCGATATCCTTGGGGAGATTCTGGCGGTAATGACGCAGGCGATCGAAGAATAGACGCGAGTCATTGAAAGACACCGTGTTGTCGTGCGTGCCGTGTGTG
ATCATGAACGGCGGGATAACGTCGCGGCGATGTTCTGCTCGCTCGTCATCCAGGTACGCGATCGGTGACGCTCGCTCAAAGTCCTCGGTGTTGCCCTTGA
GTTTCTTCTGCATCACCAGAAACTCGAGATATTGAACGAGTCCGTGCGTCTTGTCGCGCGAGAAGTAAATTCCATGTCGGTCTGTGAAGTCGTGAACGCC
GTAGTTGTCGATGACTGCGCGCACACTTGTGTCCACTTCCTCAAATCCCGGTTGTAGGGATTTATCGTCAGCAGTGAGACCCATCAAACTAGCCAAGTGT
CCACCAGCAGACTCGCCGCCTGCCACAATGAACTCTGGATTCGCGTCAAATTCCTCGCGGGCGTTGCGGCGGAGGTAAGCAACAGCGCGCTTCGTGTCGA
TTAAGTGCGTGGGGAATGCCACTCCAGGGGACAATCGATAGTCGATGACACACACCACCCAGCCCATGGAGGCGACCTGATACACGCAGGTGAACGGCGG
GATACGGCGATCACCAATGACCCAACCGCCACCGTGGATGTAGAGGAAGATAGGCGCATTCGCTGGTGCATCCTGATGCTTGTAAACGTCCATGAGCAGC
TTCGTGGTCTTGGTCTTGCCCACGTGCGCGTACGTGACCGTGCGGATCTTGCTTACTCCGGGGTAGCTCATCGAGACGGCCATGGGCTGGGGCAGTGGGA
GAAACACGCTCAGCCAGCGCTTGAACGACATGCGGCCGATGCTCTCCAGCTGCGCCGGTGCGATATCCGAGGCGACTAGCGCGTCACGAATGACCTCTTT
CGAGGAGAGGTTCTGTCCGTACCATTTCGCCAGATTAGCGGCCACCACGCACTGCACCAGGCCCGCGAACGCGCCGCTCCAGCGCGAGAAAATCGGCATC
TTCTTCTTGAGCAAGAATCCCATCAGGCACGCGTGCATGACTGCGATCTTGTGCGACAGCTCGGTGGGCAACAGCGACGCCGCCATGCCGAAGAAGTTCT
CGCGCGGGATCTTGTTGTTCTTGGCGCGCTCCACGACGTACAGCGTGGACACGGCGAACGCCAGGTACGCCCAGCGCGTCAGGCGCTCGTTGCTCAGGTA
CGGCGAAGGCTCGGGCTTGACGACCTTCATCGTGCAGCAATCTGGTGGTATTTCGCGCGGTGTACAGCCACTGTCGAGCTCCCTTGAACGGCGGACGTCA
CGCGGTGGACGGACACCTTTTGCCACACGAGGGACTCGATCGGGAAATGACAGACGAGCGCAATACAAATCTCAGATGACGCCCTAAAAAGTAAAAAAAA
TGTCGAGTCGACAAAAATTAATTGGTGCTTCGAAAAAGCTGAAGCAAATCGTGACGTAAATCATTGGATTGCTGGGGACACATGCGCACACTTCAACGCT
ACTGTATATGCACACCACATATCATAGTCGCGCCGTGGCGGTGACAGCCACAGTGTCTGCTTCCTCCACCAGCTCCTCTATGTGGGCTGGAGCCGGGGCC
GTTGCGCTCTGCACTGGAATGTCGTTGGTCTTGGCGTACAGGTTGTCGAGGAAGGCGACCACAGCCTGGCCGTGGGCGAGCGCACGCGGGGACATCACGT
AGTTGAACGCGTGGTGCGCTCCTGGAATTTCCAGGAAAACATCACTGACGCCGCCCAGCGGGCCCTGCTGGGCGCGCTGTCGGTAGAGCTGCAGCTGCTC
GAAGAAAACCTGCGAGCTTCCGAACGGGACAAGCGTGTCGAGCGTGCCGTGGGAGACGAGGAACGGCGGGATGACGGCGGGCAGCTCGCTCTCCTTCTCC
TCGCGCAGCCAGCCGACGGGCGAGGCCTTCTCCCATTCTTCATCGGCGTCGCCCATCTTCTTCTGCATTACGAGGAGCTCAATGAAGCGTACGAAGATGT
GATCCTTGTCCTTGTAGAAGTACACGCCGTGTCGGTCCTTGAAGTCGTGCACTCCATAAGTATCGATACAGCCACGGACACTCGTGTCAACCTCTTCAAA
CCCGGGCTGCAGCGATTTGTCGGCCGCAGTAAGCGCCACCAAGCTTGCCAAGTGGCCGCCAGCAGACTCTCCTCCAACGACGATGTAGTCGGGGTTTGCA
TCGAACTTCTCATGTGCGTTTCGACGCAGATACGCGATGGCACGCTTGGCATCGATCAAGTGCTCGGGAAACGCGATCTTCGGAGACTTCTGGTAGTCGA
ACACGCACACTACCCATCCCCGAGCGGCGATTTGGTAGATGCACGGGAGCGGAGGCGTCTCACGGGTGCTCATGACCCAGGCGCCACCGTGGATATACAA
CACGATCGGAGCATTGGACGGCGTATCGCGGTGCTTGTACACGTCCATAAGCAGCGGCGTGGTCTTGTTCTTGCCGACGTGGGCATACGCCACTGTTTGC
ACCTTGGCGACTCCAGGGAATGCCAGCCAGAGTGACACGGGCTGAGGAACGGGCAAGAAGACGGCCAGCCACTGCTTCCAGCTGATCTCACCGATGCGCT
GCACGCTGTCGGAGGGTACATCGGAGGTGTGCATTGCGTCCCGGATCACGTGCTTGGCGGAGACATTGTCGCGGTACATTTTCGCCAGCCGAATCATTAC
GAGGCATTGCAGCAAGGCAGCAGTCGACCCCACCCACCCCGACAATACAGGCTTCTTCGACTTGTGCAGGTTGTAGATCACAGCGGCATTGACAGTCAGC
AAGTTGTGCGAGAGCTCCGTGGGGAGCATCGCAGCGAAGAAGCTCAGCACATTCTACAACAGCAACAGCAGCACTGTCAATATACCGACGCCAAGATGAC
TAAGACTAACTCGCGCGTACCTCGCGCGGGATGTCCTTGATTTTGGCGCGGCGCAACAAGTACAGCATGCCGACCATGAACGCCAGGTACCCCCATTGCG
GCGGAGGCTCCCTCTGTGCGATGACCTTGACTACCTTCATGCCCGCTGCTTGGGGAATGCCTATGCCGTGTCCGTTCGCCGCCAGACGGACACCATGCTT
TTCGGCCAATCAAGAAGACACGTATCCAAGCCAAAGGATCCCCTTCGCGAGGTTGTGCTGTGACGAGCATTGCGCAGTAGTGAAGCAAACCACGGATATG
ATTGCCATTTACCATTCAGTATCGCTCGACTAGCTCCTGCACTGTTACTCGACCTTGATGGCCCGGTAGATTTTGTTGACGAAGAAGAGCGAGCTCTGGA
ATCCGATGAAGCCCAGCATGACAGAGAAGCAGTAGGCCATCATGCTCGTGTAGCCGAAGTAGAAGGCCGCCTGGAAGAAGCCCGTCATGTCCGCGACGCT
CGTGTAGTACCACACGCTGTAGGCGAGCACAAACAGCCCCGTCGTGCCGCCCGAGACGAACGATCGCCACCACCAGCGGTGGTCCTCGGACGAGAGTTGA
ATGTACGTGAGCGAGATGGTCGTGAACGCCGTCACGAACACGAGCATGACGAAGGACAGGAATAGGATGCCGAACAGCTTGTAGATCGAGTGGCCCCAGA
TAGCAGCGAAAATGTGGTGCAGCTCAATGTAGACGGCGCTAAACGGAAGGCACCCGGCCGCAATGATCAGGATGAAGGGGCTTCGGTAGCCGGGCACAGA
GGGGATCTCGCGCGGAATCTTGTTGGTGCGGCAAGGTGACTTGAACTCGCCAGTCGAGTTCCGTCCTGCGATGCCTCCGATGATCGTCAACGGCAATGCC
ACCGTAATGAACAGCGCGAGCACGATCATGATCGTGCCGAAGGGCAGAGCTGCGGATGAATCGTTCCAAATCGCGACCGAGTTCAAGAACGAGAAAATCG
CAACCAGGGGACCCGGAATCACCAGCACACACATCAAGATGTTCCACACCCACCGCTGACCTCCGAGTAGACGGTACATCCGAGCAGAATGGAATCCGCC
AACGCCAGCTGTGAGAGCGTAGAGGACGATGAACGCAGTCATCATGCCACCGCGCTTGTTAGGCTTCACAATCCCCAGCAACGAGGACGCAAGGACCACC
GACAGCATCACAAACAACTGCGCACCCGCACCGTTGAGCGCACAGAAAACACTCAAGTGACTCGGGAACCGGAAAACATCGGCGTGCAACAGTTTCCACC
CGGAGTCATCCTCCAGCGAGTGCTCGTCCCCAGTCTCCAGATCCGTGTACCGCGAGAAGTCTCTCTTCAGAATTCGAATCATCACAATGGACAGGAAGCC
CGTGAGCATCATAACCAGGATGAACGAGTTGATGACCGAGATCCAGTGAAGCTCCAGGTCGTCAGGCTCCACCAGCTCTTTCTCCACGTTGCGGTTCTCG
TACAGCAGGTCCGGTCGGTTGTGCCACTTCACCGAGTATGTGAAGATTGCTTCAGGCGACCTGGCAATGTTTTCAGGCGACAGCGCGTAGTGGTACTCGA
GATCCGGGTCAGACGACGCCATGGTCATGTTGACAGCCACAATCTGAACAGCAAAAAGCAACACGCCCCAGTGAGTCGACGAATTACACCACTATAGACT
CTTCGTGGCGCTTACCTTGTTCTTGCCCTCCTCCGCCTCCACGTCGTTGTAGGCGATGTCGAAGTGCAGGTGCGTGTTGAGGTAGTAGTGGAGCTTCATG
CCTTCGCGGATGCCCTCCTGGATGAGGTAGCCGACCTGGCCTCGCAGTCGGATGTCGTCCACGTACATCTCGAACTCGTAGTCCTCATCCACCGCGTCCT
TGAAGGCCTTCATGACGTCCTGCGTGACCGACAGCTT