Description :
From Genome Similarity Track
Location :
Scaffold_13:444397- 447034
Sequence
2637 bases(100 bases per row)
GAGGAAGACTCCCTGTTATTATGGTTCATCGAATTAGACAGAGCCATAAAGGCACGACGTATCGACGATGAACAAATGAAACTCACATTTGCTCAAACTC
ATTTGGCGGGACGTGCCAAGACTTGGGCCTTAGGGCTGGAGATGAGCGACCCATATGCTTTTGGGTGACTGGAAGCCTTTAAAACTCGACTCAACAGACT
TTTGAGCCTCCACGGGCTGAGTTCAGGGCTCGATCAGGGCTTCTGAAACTCAAGCAGGGTAAGCGTGATGTGCACGCTTACGCTCAACATATACGACTGC
TTGCGAGTAGTATAGTTGCTAACCCAGTACATGAACACACGTTGATTACTGTGTTCATACAAGGGATAGTAGACGGGCCCGTCAGGAGCCACCTGTTCCG
CTTAGAGTTGGATACGCTTGAACAAGCAATCTCAGCTTCGGAACAGGAGGACTTTAGCATGAGACAGGCTCATGCTAGCTCGAGTTCTTATCGTCCACCG
AGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGATATGTCGAGAGCGAGAGACCTCTCTCTTCGAACAACAAGCAATTGCAGAAGTGCAATC
GCTGCCAGAATTCGGGACAATACGCTTACGAGTGTAGTGCCCCACGCCCAGTTCCAAACAGTACAGAGCGAAATGATCGGCCAATTTCCAGAAAGGATAA
TGGGCGTAGGTCTAACGCTGTTGCGAAACCGCAACAGCGAAGTGGACCATCAAAAAATGGTCGGGATCAGTAGGGGCGGAGCGCCCTACTGATCCAGCAA
CCTCAAGAGAATTTGCAAATATCTTGACGAAAGTTGATCCAGATACACAATCATTGTGTGTCTCTGCACCTGGTGATGAGGTATCACTCATCACCTTGTA
ATTAAGTGACAAATGATTTGTCACTTCGTGCTCTAGTCGACTGTGGGGCGTCGAACAACTTTGTTCGTCGTCAGTCGCTAGAGGGTCGTAGGCTCAAGTT
CGTTGAGCGCGACATCCCTCAAACGATGATGACGGTGTGACTCGCCACAGGCGCGTCGATAACCGTTGAGAAACGTGTAGTTAGAATCCAATACACGTTA
GAAGGTGAACAGTACGATGACGATTTCATCGTACTTGATCTGGATGACAAATTTGATGTCATCCTGGGATTACCTTGGCTCAGAAGATACGAGCCAAGAG
TGAGCTGGCAGCATCGATCCGTGAAGATGCCTGCCGCTTGTTCATCAGATGGCCATCTGATGAACGTCATGGAGCGTCCACAAGCGTGTGGATGCACTGC
GAGTGAGTGCTATGGCCTCACTTGCGGTACGGTCGTTAGCACGACTGTGTAAGACCTCAGTGTGGCTGATTCCTACACTGTGGAGCAAACTCCCGGCGGC
TATACAGAAGTACAGGCAGCGCCAAAGGTCCACCACTCGAATAAGTCGAGTGGACCGGGACATGAATGCATGCCTAGCGGGCAACATACTAGGAAGAAGA
AACCGGTTGCCACCAAAGGGCAACACGGTCATCCTAGGTCGACTGGAGAGTCGACCGTAGAGGATCGGTACCTGACTGTGGTTGCACAGCCACAGTCAGA
AGACGTCGAGAGAATAAGTCCCCACGTACTTGAGGAAAGGATTCGTCAAGAGTTACATGCTGAGAGAAAAGGCTCTCAGCAACCTGAGATAACAAGTTCC
CAGGAAGAAACCGAGACATTGAATGTCTTGGTCAATGACGGATCAAGCGTAGGCGCTTATACGCTTGATCTGATTGTGCCTCCGAAGTTAACTTCGGAGA
TAACTCAATTGACAACGCTGGAACCGAAGCGGTTCCCGTGTGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGCATACTTGTCACAGAGGATGAGTATGT
GACCGATATTCGGTCGGGCAACATTATTTGCTGAGAACGAACGGGTTCTCAGCAGCTCATCGATGGACGAAAGTGTCCTCGGTGAGAAGACTCGGATTGA
ACGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTGTATAAGGATTTGATCGAATTAAAGGATGTGTTCCCTGAATCCGTGCCATGCGAG
TTGCCTAATGACAAAGGCACTCGACACGATATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAAGCAGTGGCCAATGCCTCGTGAACAAGTACTAG
CGATCGACAAGTTCTTTGCCGATTGCTTTGCAGCGGTCCATGTGAGGGAATCCACTTCCCCTCACAGCTCTCCGACCTTCTGTGTCCGAAAAGCCACAGG
AGGATGGCAGATAGTGCACTCATTCAACAAGTTGAATGCCGCAACGGTACCGGCTCAAACGCCGATACCGAGGAAGGACGTAATCATAGATGGTATGTCA
AAAAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTCTACCAGATCCTAATGCGTGAACGGGGCATCCCGTACACAGCAGTGATCACCCCCAGCG
GTATGCTGTGGGAGTGGCTAGTGATGCCACAAGGGCTGAGTAACACCCCTGTAACGTTCAACAGATGTTAACAAATCTGTTGAGACCGGTGCGGGACTTC
GGACCGAGTTACTTTGACGATGTGTTCGTCCGTAGCC