Description :
From Genome Similarity Track
Location :
Scaffold_339:44439- 48247
Transcript NameFunction/comments
Phyci_257587hypothetical protein

Sequence
3808 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNgacgacgccgtcactgaggaagcagcatcgcgctgctcctttatgatgaagcccagagcaacaccatgttgctctgtcggcgata
acgtacgcagcatcgtagctaccgccgcctccccaatgacagttgacagtcgttggagggcctcccactctgggtccgacaggtgggggcagtccgcgcg
tgcaacatgcgttgcaggcgtgttggagctctccatgggcacctccgtgctcatggggttctcggctccgcgttcgtgcacctcgtacgaacgtcaagcg
gtcggtcgttggacggactacaaagtgctaccaggtgtagtgggcctactttggctcaatgctttaacttacacgtcgcgctacgtgtatgaggaagcgt
aggagtttatgaataatttgaattaattatacttgagtccacaagtataatataaataaaataaaacaccaagtagctagtttaaggtaaaatgagaatg
tattgtttgtaaattgatcttcctcctaaatctgctaaaactgtttatcatctataaaaagggttggcagcggctggctgtcagagccccgcgaatatgc
acatctctaattggtagaaagatgcttctttctaccagtaggatctttggtaggtgtggaccactcattgtggtggcccacttcaatgtatccattggtg
tgacttacaccaaggtgaggaagtatctaaaacctttaacagatatttatttgttaaacaataagtgacaattgtcacgcacaagtaaccgttgtcaGGG
CCTCCGAAAATAGCATTGTCAATAACATTATTTCCGAAAATAACAATAAATTATGCATTTCCGcgggtcaagaaatttaccgcgataacttattttgttg
acttgtgatattacataatttatgacagacatcttTATACAATTAttttgctgctaaccagtcatctactaggttccagttgttcagaagcgctgggatc
attggtcgtccgcgttgctagtcaccggcagcattcacgtttcaatttttaccgctcaaagccaccaagtccccattcccagcattgcccgcgctacccg
ccccctcttcctacgtacaccaactcccaattttcggggttctgcttccgcccgtgccgtgacgagaatgacgaggtgattctcgagtatttccgctgcc
gttgcggcacggtgcggaagcagacccatcgaaacgggtactccaacctgatgcaacatgtcaggcgagagctccctgactacgagactgtcatgctcga
cgttacgacggcagaaacaggctccctcgtcaacttcgtacgccactcagcgctcaacttccacggctggatggtatggattgtcatgtgcaacctgcca
ctatccttttgtgagaaacgcgaagcaaggcagtacgTGTATACAtgcttactttactatcgaaagaaacggctttattttatggatgttattcagctac
tccagcctggaccgcatctcggaggaaacgctgcgggctggcatggacggggtcgtcgtcgccgtcgagcgttcgattgcgtctgagcttccatcacgct
tcggtatcatgttcgacggctggacccacgcatccgagcactacatcgccgtgtttgcgtcctacgaggtgaacggcagcgcaaagacaacgctgctcag
catggcgccgctgctcgacgcgctggacgaggacctctccgcccaagggcacctcgagttcctcgccaccatgctgccacgcgactatggcgtacagctg
gcgcagtgtcgctttcttgtagctgacaactgcaccgtaaaccgccggctggcgactcttatgagcgtgccgcttattgggtgcgcaagccactgactga
gccttgctgttcaggcagacatggcggcgtatgaggacaacctggctgctgttcaggcactcatgatcaagctacgtactctgacccaatctgcgaaact
acgataagccctattgggtatatgtagtgtgtcaatatgtttctaacacaatttgtgtactttttgtaattttgcaaaaaaaggttgaatactccacttc
ggcatgtcatccgccaggacacgcgctggagctctacgttcgagatggcccggcgctacctcaagctcctcgagttcctcgacgtcgaagacgacgacat
catggagctgctgcagccgccggcggcgaacaaccgactgcgcgccctgtaccaaaagctttgcgatatcgagtcggtctctaaggcactGGCCCTGCAG
ACGGTGTT