Description :
From Genome Similarity Track
Location :
Scaffold_41:444368- 446949
Transcript NameFunction/comments
Phyin_T30-4PITG_16026Putative uncharacterized protein

Sequence
2581 bases(100 bases per row)
GTCCTGGTCGTTTTTTGAATGAGCGACCGAGGAATGTTCCGCATCGGCGTGAGCGAAGACGGGAGCTGGCGCGCGGCACTCCTCCGCGCGGTGATCTTTC
TTCCCACAGCGGAAGCAAATGAGGGAGCGATTGCTTCGCGCAGCGCTACCGCGGTAGGACCCGCGGCGTCGCTCGCTCGACGCGTTGATGGCGTCGATCT
CCATGGGCTCGGGAGTAGACTCTCGGGCTTCCGCAGGTATGGCTGCGACGTACGATGCAGCGATTATGTAATCCTCGCGAATCGCGCGTGCAAATGCCTC
CTCGAGAGAGGAGGGATCAGCACTGGTGAGGCAGTAGCGGATCATACCCTCGCGCATGCCGAACACGAATACGTGGACTTGCAAGGCCATGTCGATTGGC
TTGGTCACGATGCATGACGCCAGTTGTCGCGTCTTCTGGACGTAATCACGCATGGAGATTTTCCCTTGCCGAAGAGCGAAGAGCTCTGCGCGAACGCGAG
ACTCATCTTGCGGGGGCTCGAACGCGAGGCGCAAGTCGCTCTGAGAGTTTCCAGAGTCGGGAAAGCCTCGGGGTCGACAGCCCAGCTTCGCAAAGGGCCC
ATTCTTTGGCCTTCCCGGTCAACCGGGAGAGGAGGAAGTTCATCTTGGCGGATGACGCCTCGATGCGTCGCGAGGCGATAGCGATGTCGATCTCGCGGAA
CCACCGGTTTAGCATGAGCCGGTTTTCACCGGCACCAGAATACGTAGACGTCTCCATCTTGACGAAGTCATTCTGGGATGAACGCGAGGGAGTTGTCACC
CGCCGATTCGCATCGGCGAGCTCGCGCTCCATGAATTCTTGTGCTGCAAGACGTTGCTGGTCGGGCGTCGCTCACCTCAGCATCGATGCGACAACGGCAT
CTCCGGACACCGCCACGAGGCGGTGAAGCGCTTCTTACTCCACGCGAGTAAGATTGTGGAATACAGCATGCTCCAGGGTCGCCCCGGAGATCTGGCCTTG
GATCATCGTAGACTTGGTCGTTGGAAGGACTACAAAGTGCTACCAGGTGTAACGGGGTAAGAGATACCGTCACTAGCTTACACTATAGTGTGGAGGAAGC
TTGCAATAGTAAAACCAAGTCTTAGGTTTGTGTCAAATTCAACTCTGATTTCTTTAGGACCAGGGCGGCTACCCCTGGCCTCGTGTGAACCACTCATACA
CATGTCTACACCTGATTGGTCAATAAGTGAGTCTGGCTCCTCACTATTAACCAATCTGATGATGACACCTTGGCACGCGCGTGTGCCACTTTACCTACTT
ATGTAATAACTTAAGAAATATCTACCTACTTATGTAATTGGAGTTGGGCGGATTACAATACAAGCTGTGGGTCACTATGCGCACCCACACTCTCGTGTTT
ATGCGCCCATACGCAGTATTTACGCCCACTTTCATTTTTTGGTGTACCCCAATCCGCAGCGCGCCCGCGGTAGACTGAATCTACATTGCTAAAAAAACCA
TTTTTGTTAAATTATTCCTGAAATTTAGACGGTTACTTTACTCCGTTTTGGTTTACAGTACCACCAGCTACTATTAGTATTGTAATATTCATATTAGTAG
TGAGTTGAATCTCGAAAAAAAGTGAGCGGGTTAGTAATATTAATAAATCATATTTATTAATTAAATACCTCATTTTATCATAAATCGGCGTAGCTAAGTG
AGAACGACAAAATTGAAAGCACAATAATGCATCTTAAAAATTTGTACTGTTTTAATAAAAATGCTCCCAAGCAAATGCATTTTCTCTTTGTCGTGGTTTT
CTTTGAAGTATTTAGCGGTTTTGACGAAGACGGAAAGCACAGTTGAGTGCGGATTTGTGCCCTCCCATCGATGTCATTTGACTCAATGCTGAAGGCTGCA
AATGGTCAAGTATCGTGCAACCAGTATGTATCGGTCTAGTCCGTATATGGAGATATTGGAAAACGGAATCACCAAAGCTGAATTTTGGTAGCCATGGTAT
TATACAACCACGTGATAGCACGGACGCAGCTATTATAAGCAGAACGGATAAGTGAAGACTATGATAGTCACAATCGGGTCAGCGCGAATCCCAGAGAGCG
ATGGCTTCTGCAGAGCAGTGGACTCCCAGCCTGGACCGTCCAGGTATTGCTAGCAGCTGCAGAACGTTCACGTCAACATTTTCATGTTGAAGTGCATGAT
AAACTTCAACATCGTTGAAAAAGCTGTGATAAACATGCCATGGTCAAGCAGACCCTCTTCTCATTTCGTGATTTGTCTAGGCGAGAGGGAGCCCAAGTCA
TTAAACATAAACATTTATCATGCCAACCACCGCACCGACTCGGCCCGAGCTGGAGCACACACCGATGAGTGAGCAGGACCCCGACTTTGATCAGCAACAG
GAGCTCTTCCCCAAGACATTTCCAAATATCCGCATGCTGGTGTTCCCATTCCGATTTCTCGGATACTGGCTGGGTCGCAAATTATGGTCGAATGATCCGC
ACGCTTCGCAAGCGCGGACACTGCTAGACGACATCGTCTATGGTGAAGGTCCGCGCTTCCGAATTTCAACGAGCGAGCTTT