Description :
From Genome Similarity Track
Location :
scaffold_189:44436- 51097
Transcript NameFunction/comments
g5362.t1hypothetical protein

Sequence
6661 bases(100 bases per row)
GTCTTCGGCGCAGCAGGAGCGCTTCCGGTCTGGCGGACGTGACACTCAACAGCAGCATATGCCGACGTCGCTTTCGCTTTCACGTTCGAGTACGGTTCCA
GGTACCAGCAGTGCCCCCAATGCTGCATACAGTGGGGCATACACGCTGAGTCCGCGGATGTCGTCCGAAGACTCGTGGTCGGGCAGCCAAGATGGTGACA
ACAACGCCATGTACCAGGAGCAGATGCACGAGTATTATGGCAACAACCAAATGGCCTCGTATGCCGTTGAACAGCAACAGTATCGTCAACAACAACAGTA
CCGATCGCCGCAGACTGCAAACGGGTCGTACGGATATGGAAACGCCCCATCTCGGGCCCAAATGAACTCAGGTCAATGGAACCCGATGGTTGTGGGTCCA
CACCCGCCCGCTGGAATGTATGACGCTGGTGGAAATAACATGTACATGAACCCGCGCTCGAGTCCGATGAGGCACCCGCACGCGCAGATGGGATACGCTT
CGCAGCAGATGGGGATGCGTGGCGGAGGCCACACCAACAACCGAGCCCATGGACGTAACATGTACTCGCGTATGACGCCGCCGCTCCCGGAGTCGTCTCC
TCCGCACTCGCCTCGTAAGGGCATGGGCATGCAGATGGGGATGAAGCAATGTAAGTTCTTCCTGCAAGGCCATTGCCGTATGGGCAGCAAGTGTAAGTTT
GTGCACCAGGCTGGTGCTCCAACTCCGGAGCACATGGGTGGCGGCCACAACTCAAACCGTCAGAACGCTTCGATGATGTACCAGCAGAGTCGGATGATGA
TGTCGCCTCCTCCCTCTCAGATGATGCAGCAGCAACGCCACCAAATGGGGGGTGATGATCAAATCAATGGAGGATTTGGAGGACGCCAGCAATCGCGGAT
GAGCTACCGCTCTGAAAACGCTGGTGCAAGCGGTATGAGCATGGGCTTAATGAACGGTGGTGGCATGAGTGCACCCATGATGGGCAGCTCTGCAAACGAT
CCGTCAAGTCTGAGCGCTGCGTTGAGTGTGGAAGACATCCAGAATCGTGTGTTCGCGATGTCCAAGGACCAGAACGGCTGCCGGCTTCTGCAGGAGCAAC
TCGACTACGAAGACCGTTCCGATCTGTGCGAAGTTATCTACCAGGAATCCCTGGAGCACCTTGCTGAGATGATGGTGGATCCGTTCGGGAACTACCTCTT
CCAGAAGTTGCTTGAACGTGTGAATGAGAAGCAGCGGCTTGTGATTATCCGCCGTGTGAGCTCGAACCTCGTTGCTGCTGCTCTTAACCTGCACGGTACG
AGGTCGGTGCAGAAGGTGGTTGAAGTGTGCGCAACTTCGTCGGACGTTATCGAGGAGGACTATGATGAGGAAGATGGAGATGACTATGGCTACGTGAACG
ATCATGAGGAGCGTCGTGAAGGTGGTGAACGACGCAGAACGACGAGTCTGCCGGACATTATCGTTGACGCGCTCAAGGACGACGCTGTGCGTCTGTGTAT
TGACTCGAATGGTAACCACGTGATCCAGCGTGCTCTACAGTTCATGAAGCCCGAGTACAACCAGTTTGTGTTTGATGCGGTGTGTAAGGAGTGTACGACT
GTTGGAACGCACCGCCATGGATGCTGCGTCCTGCAGCGTTGCCTGGACGCGGCGAACAAGGCGCAAAAGGCGGAAGTGATTGAACAAGTGGAGCGCCAAG
CGATGAAGCTGATGCAAGACCCGTATGGCAACTACGTTGTGCAGTACGTACTCGACTCCTGCACGGCTGAGGAGGCCTTCGGTGTCATTATGAAGCCGCT
GGGCCACATCTACGAGCTATCGGTGCAGAAATTCAGTTCGAATGTGATTGAGAAGTGCCTCGAGAAGGCCCCCGAGCGCGTGCGTCAAAAGTACATCGCT
GAGATCACGGGCTGCCCAAAGATGAACAAGATGCTGCAGGATCAGTTCGCGAACTATGTGGTGCAGCGCGCTCTGTGTGTTTGTGCTGAGGAGCAGTGCC
TGCTGCTTGTGAAGGCCATCCGCCCGCACCTTGCGGCAATGAAGAACACGTCGGGCGGGCGTCGCATCACTGCTCGTATCCTCAAGCGTTTCCCGAATAT
GGACATCAGCATGGACATGGGCATGTCGCCGACTGGCGACAACCTGTTTGGCAATGGCGCCAACGGGATGATGATGGGGCACTTGCCGGCTTCTACTATG
GGCGGGGGATACATGCACCAGCAGCACTTGCAGCCAAACCAGATGTACGGCATGCAGGGCGGTCACATGGGCCCTTCCCACCACTTCCAGGGACCTGGAG
GTCGTGGAAACCGTATGCAGCAGATGCATGGCAATGACGGCAGTATGATGATGCTGAATGACGTGAATGGAATGGGCATGAACGCTACGAGTCGTGCATA
AAGGGAATGAGAAGGCAGTCGATCGGTGGTGGGATAAAAAACTATGAACCAGCAGTCGGGAAGTGAGCGTGTGGTGTATGAACGACGAACAGCTTAGAAG
ACCCGACAGTGTTGGAGACGCGGAGTAAGCAGGTGTGGTGGGAATATGTGGATGGCCACCAGCGAGGAAGACGCGTGGGTATGAAGAAGGTGATGAAGGC
AAACTAGTGACAAGGAAGCAGGAAAAAGATCCAAAAGTTTTGCGCGTTTGTAGATAAGACAGATACAAAAAGAGGAATGCATGTTTAGGACTTGTATCAA
AGCAAAGAACAAGGACATTGAAAAGCCCACGGCGAGCGGAAATCGAGCGCAGCAGCAAGTGAACAGTATGGCTGTATCATGATACTTTTGGCAAGAAGAT
AATCATAATGAACGAAGAAGCTTTTGAGGAAAACTGTTTATCAATTCTTTTAAGTTTTACGAGCGAAGTAGAGCCTCAGCACCTACTTCGTTCTCGATAG
ACACCAGCACCCGCAAATTCACTCCATCGGCTGCATACTTTGAGATGATAAAGCTGACGAGTTACTACGTAGTATGTGCTTCAAAGTTGATTTAAACAAT
AGAATTAAACAAAGAGACACTAGATTAAAATAGAGAACAGCTTCTGAGTCAGTGTCTTGAAGACGCCATGGAACCTGCCCCATTAACAGCGGTGGCCCTC
GTATTCCGGTCCAAATCCAAGTTCGCAGGACTCCCGCACGTCGTCTCTGCTGTCTCCCTCTTCCTGGACACTTTGGTGGAGGTCCCTCTCCGTGCAGCGT
GCAAATTCGAATCTGTCGTCCTCCTGGATCGCATCTGGAGCTACAGCGATGCGTACGGCTCGAATTTCACTGGGGAAAGTGCTGGAGCTCCGTAGACAAT
ACGGAAATACCTTCGAACTTATCCTCACTACAGACAGTACCAGTTCACGAAGTCAATGATGGAGGCAGTGCGTCTCAGAAATGTGGAAATGGTTCATTGG
CTTGCAAGCAAGTTCCCAGAAGCTACGGTAATGATGAAGGTGGTCGCTCAAGCTGCTTCTTCTGGGTCTCTAGAGATCCTACAGGTCTTTTATGACCGAT
GTGCGGAAGATCCGGGTCTTAACGTGCGAGAAACGTTATTGGAAACAGGTGTTGGAAGTCGTAGCACTGAAGTGGTCGAGTGGGTTTACACCCATTTCCC
TCCCAGTCCATGGGGTCAAAGCAAAGCGTTAGAGGCAGCAGTCTGTAGTGGCAGCATTGCTATGGTGGAACGGTTACTGGATCATGGGGTTACGTGGTGG
ACTCGGAACCTTCCAACGCTCCGATCTGCTCATTTCGTAGCGGAAGAATTGGGAAGCGTCGAGATGTTGCAGTGGCTGGACAAGCATGGACAACTTGAAG
GCCTCTGGGGATTGGTGATCAAAGCTGCAGGAAGTGGATTCGCCGATGCTGTCCGTTGGCTACTTGATCGTGGAGTGAAAGACGGTGAACAAGGGGAAGA
ATTTGGAGCGGAGATTCGATTTGCTATTCACACTGCAGCCAGCAACGGCCACTTAAGTCTGGCGAAGTATCTCCAGTCACGGGCGTATACACCGGCAGAC
AGTGAGTCGAGGACTTTACAGAGAGCTCAAGATCAGCAGCGACTCGAAACATTTAGGAATAGCCATGACTTGTGGTCAACAGCTATGGTACCTTGCCAAA
CAATGGCCAACGCCTCGAAGAAAGGCTTTCTCGACGTTGTGCAATGGCTTTACACGGAGTTCGCGGACGACCCAGATTTGTTTGACCACGACCGATGGGC
TCATGGGCTCTCCAATACGCGCGTAACGGACGGCGCTGCTGAAAATGGTCACTTGGATGTGCTCCAATACTTGCATGAAGTGCAATTGGCGATGACATCC
AAGAAACGGAAAAGAGGTGACACTCAAAGCCGAACTGCAAGTATCCCAGAGTTTAGTATGAATACAATGGATGCTGCCGCAGCGAATGGCCACCTGACTA
TCGTCCAGTGGCTTCACAATAATCGAAGCGAGGGTTGCTCCAGCGGGGCAATGGCTAGTGCTGCAAGGAATGGTCATTTTGAGGTGGTGGAATGGCTATT
TACCAATCGACCACAAGAATTAGAAGAACGTATTTGGATGTTTGCTATGGGTTGTGCGGCGGAAAATGGACATTTTGAGGTGGTGAAGTACCTACATGGC
AAGAAGATGGGTTCGAAGGACGTAGTGAATCATGCTGCTTTGGGTGGTAAATTGGGGCCTGCGAAGTGGCTGCATAGCAGTACAGCAAAAGGTTGTACCG
CGATGGATAGTGCGGCTAGGAGTGGAAATTTGGAGCTCGTCAAGTGGCTCCACTACAACACGACGGTAGGATGCACGACTGCTGCAATGGATCAAGCAGC
TCACTATGGGCATTTGCATGTCCTCGAGTGGCTACACTTGGACCGAACCGAAGGTTGCACTGAGAAGGCATCGAAGTACGCGGCCGAGGGAGGGAATCTG
CGAGTGTTACAGTGGCTGCACTCACAATGGCCTACAGTCTGTTCAAGTAAAGCACTCAACTCTGCAGCGCGGTTTGGACATTTCGAGGTTGTGCTGTTTC
TCCACTCGCACTATGCTGCACAGTTAATTATTGATCCGTGGCATCACATCGTCGACAACGACCTTCGCGCATGGGTCGAAGGCGCAGCAAACTTTTTAAT
CTTTGAAGACCTCACACAATAGTTTATTGGAAGTCCTTTCTAAAAGGCATTGGTTTGCAGAATTTGGCGAAGGTAAAAACAGCAAAATAATTCGCACAAA
AACTCGAGAGACACTAGCTCCGCTACGTGACTATTTTTTTTTTCAAGTCATCGACGATCAATAGATGCATAGGCGACCTGGAGCGATGCTCCGGAGGGTA
CACAGGTCGAGGAAACAGTGCGATATGGATTAGAGAATGCATTCAATAGGTATATCACAAGCTGCTACAAGGCAGCAGAGTTCATTGACTCGAAAGTTGG
CTACTTACATATTTCGCGGGTATAAGGCGATTGGCGGGTATCGGGTTGCGCTTCATTGTCTGGGAATTCGGCACCGAGAAACGTGTTTAAAGCCCTGAAA
AAAATGCTGGTTTTGCCGATTATTGACGATAATTTATTCTAGACTCGAATTTATTGAGTCTCGCTGCAACGGGCTCCACTGTTGCCACCTTCGCCTATAT
GGCCTCTCTACAGTAGTAGATTCGGATGGCATTTGGATAACCACCGGCATAGCTTTGGGTTGATCAATTTGCTTGTTAGCCTGACACGTTCTGTCGACTG
TGCTCCATCGGATCGAGTTGACACGATTAATCATTGCCTACTGTTGCCACAAGAAACGCAAACAGGAGAGCAACGCAAAGAAGGCATTCGATGTGAGGCC
TGATGCATTACTACACTGGATAGTACTTCGAAGTGGAAATTTATCGTTATTATAATACAAGTTTGCCCAGTAAATACAGTGAAAAGGTATTGATTTGTAG
TTTGTTGAGTGTACAATTCCTTTTTTTTTTATGATGAGGTATATTGGATTACAATCTCAGAATCCTAATAACCCTTCCTTCGAACGTATCGTTCAAAAGG
TTGAGTGTACAATTCCTACTCGGAGTACTACTACTGGAAGCATGGATAGCTGAATCAAGTGGATGAAATACACAGCGCTCCATCAGGAGCTTTCAGACCT
TGTAGTTATGCTTGCAAAGGAATTGAACTCTCGTATAGTGTAACAACTCGACGTGATGCTAAATGGGCAAGTTCATCTGTCGTGCTTTCTCAACTAAGGT
ACATTGATGTCACTTAACTATTTAGCTAACGACACTCCGATGATGGCAAGTCCATCCGTACTCTGAGTGGAATGGCACTCTTCAGTGCGGCAATTTTGCA
AAGAACCAGAACTTGGTCAAGGCCTCGTTGAACCGTCTAGCTGGGCAACATCGTGGCCATCGTCGTCTTAGCGTTAGGCGTGAACAGGTACTGAAACTAG
CTTGATAATGAAAGTATTAAAGTGACTTGCACCTATAATTTTACGTGGTATCCGGTTGAAAACAATATCTAGTTTTGCGTCGTGAATATAGCTTCATATG
TAAACGAAGCTTCATGAAAACAGATTTGCATGAGGTCTGGACTGTAAAAGCATTCCTGACTCCAACACTTGCCATTTAGTATTAGAACGATAGTATCGCT
AGCATTAAACTTGGTACACCACAATAAAATTTATTGCGGCAGTCAGCTGACCGTTCACCGG