Description :
From Genome Similarity Track
Location :
Scaffold_29:444191- 448839
Sequence
4648 bases(100 bases per row)
GAAGCGTCAAGTTCTACGAGTACTTGGTGTAGTAGCTACAAACACAGGTAGGACATGCCCCTTCCATCGCGATTGGTCAGTATCTTCAAGAGCTGTCGCG
AATAGCGCTAAGTCCTCACCCAACAGCTTAGTCACGCTGAACCAGCTCCTCCTAATTCCAGCTGCTGCACGCCCCACCGGTTGCCTCTTTGACCTTGGTT
TGAATAGGTGCAACAAATCGTCCGGAAATCACGACATCAAACAAAGATGAGTTCAGTCCTTCCTACGGGTCTTTCGGATGCTGTATGGGCCGGACACTGT
GTTTGCTCTTTCTCCTTAAATTCTGGAGATACACTTCCACTTCCATCATGCGATGGTGTGCTGCTTGAGCTCGCTAGGTCTCTTATTTGCGTTTTTATAA
TTAGTAATTGTGCTTTAAGACGGCGCGGGTGTTTTAGGACAGGTCCTTCGTCACTATTCTTGGTGGCTCAAAGTGAGAACCACGATAATCGATCGTGTAT
GTGTTGTCCGGCGCCAAATCGTAGGGTATCTCACTTTCCTTTGATTGAAGGGTGATGTCGAGCAGATATCGAAGCAGCTTCTCGGCTGACTCGGCGATGC
CCCACTGGACCCACCACTAAATCATACGCAGCGACCAGCGACGGCCAGGCTGCACATACATAAAACGATGTTGGACACCCGCACGGCAAAATGTGTGTGA
AGTATGCCAACTGTTGGTCTAGTGCTTGGCAGCAAAACCGTGGATCTATTTTCCATTCCTATTAAGACCTCATCCGACCTTTAGGCGTTGACCAAGGAGA
TGAAGACCTGCTCAGACATCTTCATTCTCCAGCCGACGCACACCTTTCACAGCCTGTAGCTCGATTTCGAGTCTTGAGTGCTTTCTTGCGGATACCATTT
AATGCTGGAAACATATAATCCTCGTCACTTTACTGGTGTTCCTATCTCTCGAAAGCGGAGCTCACCCCGTTGCAGATGTGCATGAATGTGTTGATATTTA
ATACATCCTTGGCTACAATATGCAAGTTATTTTGCCATCGCGCTCTCTTTATTGGAAAGCTCATACGTCCCATACTCGATGGCTTCGTCACGTTCAACAA
CACTTTGGTGGTACTGGCCCAGTGAGACATCCTACGACATGGTAGTCAACACATAGTAATTGCGGTGCGTACTGTAGCAGGCGAACGACGATGCATCCTT
GTACCACACGCGACTTTCCTCGATAAATCCTTTAGCACCAGCGGTAGGGGGTCGAGAAACGCGTGAAGTACCGAAAACATGTATTACGATATCAGGCTGG
CACGTTTTTTGACGCATTCTTCTTCTTAAGTTCACGCATGAGCTAACGTACGAAAGACTCTCTAGTATATTCATATTTCCATATCCGCGGTTTTCTTCAT
CTTCCTCTTCATGAACATACCAAGTGCTCACATCGGTACCATCACTATTTCCATGAGAGGAAAAAAACAAGCGATGGGTGGCCTAACTTCTTTAGCTGTT
TAGAGCGAAATAGAGCTGGAGGCCGAGATACGCCGCAAGTATGCAACCAATACTACCGGGATCTCGTGGTGGTGCCCGTTTCGATGATCAAAGTAGCAGT
TAGCCACACACACTTCTCATAACTCCATGAAACTCGCTTCGTAGACAGTCTGCATGATTTTCGTGATCACATCGTTAGCCGTTCACTGGCCCTCTTTTGC
CAACTCTTAAATCTCCATATTTCATTGAAGAGTCTGATTGAGAAGTGATCACGTGGCTCACAGCCGCCAAAAGGTTGGCGTTCTTTTTAGTATGAGCTCG
TACGCTTAGGTCTGATCAAAACGGATTGGATCCGTAACCTGAAACAGCACTCGAATTGTATCCTCTTTCCCATATACTCAATAAGTTTAAAATGAAAATA
CGCCTAGTCCTTAAAAATGATTTTACAAAAGTTGGTTTCAAGTCGAACCTGTGTATTATGACTTTGGTAGGAGACATCGTTGGAAGCAGATTATTTGTCG
CAAAGCAACGTTTGGTCGTTGTTTGGTGTTATTTGAACAGTCAGGATGGAAAAACCGGTCATATACATTGTCGACTATTTTTTTGTCCTCCTACTATGAT
GCAAATTTTAAATCTAAAATGTAGTCAGACAAAGAGGAGCTACTTCTTTAACATTTTACTATTGTAATTTTAATCTAAATTTGCCGTTTTGGTCCTTTCA
CTGGTTTTGAAACAGTCCAGATCGTACTTAAGTCATCATATTTTGTACTTTAGAGTGAGCATTTAAGCCATGTATTAAACAGGGTTGCGAATCAGTAGAA
CCTCGCACGGATTTATTGAGTAGCGCGCAAAATAGAAGTTTTAAAATAGATAAATATCAAGTCAAATGTACTTTACATTACCGGTAGATACAAGCAGCTA
ATGTCATTTGTTTGAAAATATTTTCTCTAGAAGGGTTGACCAATCAGAGAGTAAATGACCAAAGTTCTTCAATTTTCCGACTGCTGTACCGATGCCAGTA
TTTTAGAGGAATAATAGCTTTCTGTCCATTGTTGCCCTCTCGACTTGACCACGTCTTTGTAAGCTGATATTTGCTAAAATCTCCAAACGCTCCAATCGTC
AGAGCGCAAGGTCTTCTGCAGCTTGCCGCACATGCATTTTCGAAGCTGTGTATTGCTATCAAAAACTGAGCAAAACTCCCCACGTTCGGTGCAAATAAAT
AAATTGATATTGTAAAGTTGAAATTGTGGGGACAATATTGATTGTCAAGTCCTCCACAACATACTGGAGCTGTTTAATAATTTTCTAAAAGGAAAGTAGA
TTGCACTCTTCTCAATCGCCTGTGAGCTTTTCGGTGGGGTCCCGTACAGCCTCGGATGTGAATTCGTTGGTAGCAATGTCCCAATTTAGCTAGCTTGTAT
GGATCTCCATTTTTAACCGACCATGTGGTAGTCATGGGACAGCAACACACTTAAAGCGTCATTAAAATCTACCGCAGTCCATTGTAGTTTAGCTGAAGTT
CTGGTGCAGGCGATACACGTGTTAAGATGATATGTTAGCTGACGCGTATTACGACGGTGATCTTCTCTAGTTGTATTAGACCGCCGGTCGCTCATCTATG
GTGCTGAGCAGGCACCACTCATGCGCGGTTCGAGCCGTTGAACCGGTTCAGTAGTGATCCGTCCTGTGATTGGTCCATATCGTACAATACCTATACGATT
GGTAGCGACGATAGGTAGGAGCAGTTAGTGCACAAAGGGCAGGAAAGACAAGTGGAAGAACGATAACATCAATCTTATTCACGTCGGCTTTAACCAGCAA
AATAACAGGCTAACAGTCGCAGCAGGAACCCTACCAAGCACGCCCCACCTTCGTTCGACCATGACGTCCAAGCGAGCCGAAGTCCTCCTGGGTAGTTGAA
ACTACTTCCACAGGGAGGTTAATATGCGCATGACGTTGGCGCGCAAAGGGTTACTGGTGCACGTCCAAGTCGTCAAAAAAGAGGCGGGGGTGACTGAAGC
TTGGCTCAGCAACGACGCTAAGGCACTGGGGATCATTGCCCAAGGCGTCGAGCTGAAACACCAGACGAAGATATGGTCTGCGACGACTGCTATGCACGCT
TGGAACACTCTGCAGGAGTTCTACAACCGTACCACGCTTCACAACCGTGTCGAAATGACACGCCGTCTCCATGAGTTCAAGATGGAGAACGGCTCGACCA
TGTCCAAGCATTTAAATGCTTTTGACGAGCTTGTTGTTGGTCTTCAGACGCTAGAAGAACCGGTCGACGACTCAAGACAGCTAGTCGTACTGCTGAGCAG
TCTTCCAACGGAGTATGAGCTGATTGCGTCTATTGTAGAGAACGCTAAGGATATTACACTCATTGAGGTCAAGGAGAAGTTGTTGAAGGAGCACGAACGG
TTGCAAAAAAGGGAAACGATAGAGAAAGCGTTTCCTGTGAGCGGTATCTTTGGACGGTTCAAGGGCGGCCAAAGTAACGGTCGAAAGGGGAACAGCCCAA
GAAAGAGCGGTAGTAGCTTCAAGTGCTAGTGATTCAAGTGTAACCGAGTTGGTCACATGAAGCGGGACTGTCTGGGAGGCAGCAACGGTGCTGAGGATGA
CGCGGAATTTGCTGTGGGCGAAGAACGGTTAGCTGGATGGATAGTCGATGGCGGTACGACCTCGCACATGACACCGAACCGTGAAGATCTGCTCGAACGG
TCTCGGGCATCGAGGTGACAATTGCAGATGACAAGAAGTTGCAGGTCGCAGGCAAAGGAACGGTCAAGTTGAACGGTATAGATAGCAAGCGCATCAAGAT
GGTGGAAGTTCTGTACATCCCAGGACTTGACAGACGGTTGCTGTCGGTTGGGAAGCTTGCAGAACGCGGTTTAAGAGTGGAGTTCCAGCGTTCGTCGTGT
GGCATCTGGGGCAAGAACAGTGCTGTTGCACTGGGCAAGAAGGCTGGCAAGGCGTACGTGCTTGACTGTGAACAAGAAGAAGCACGGTTCGTGGAATACG
CCGGGGTTGACAACCAGTGGGAACTTTGGCACGCTCGCATGGGGCACCCCAGCGAGAGCGGTATGGCCAAGACTCAGTCTGCCACGAACGGTATGTCAGC
TGTGAACCGTGGCATTAAGACGTTATGCGGTGAATGCATGAAGGGGAA