Description :
From Genome Similarity Track
Location :
Scaffold_324:4441- 10395
Sequence
5954 bases(100 bases per row)
CTCAGCAGTATGTACGCTCTGAGAGCTAGTTTCAGTGTGGCCGATGTGCGTCTCGAACGCAAGCTTTGGTATGACTATGCCAAGCTTAAGGCTAGAGGCC
AATTACGCAATCGCACGCGCTATTCTTTGGCTACTACGGTAGCCGCGGGTGCTGGTCAGACTGTGACCAACAACCCACCAATCGACACCACTAGTGGTGG
GAAACGGCCTCGGTCTCAAGATGACCCTGGCCACGATGCTCAAAAACATCCACGGCGTTTGGGCAGTCTTGCCGAAGGAGAATCTCATATTCCCATGAGT
TCTCCGACTCTAGGTACCCTCGCCACTTTACCAGGTATTTGTATTGGCCATGGCGACGAAGCCGTTTCAGGAGTCTCTCCACATGGAACTGGCGGTTCTC
TTTCGCATCGAGCAGCGTCGGTGGGGGTCGGTGTACCGAAGGAGGAGCATGATAGGGTACTTCTCGAGCTGAATGGTCTCCGTGAGACATTGGGTAAGAC
CCAGAGTGCGCTAGACGCGACGCAAGCTCGCGTTCAGGCGTTGGAGTCGGGCCACACCCGGATGGAGGTCCAGCTTGATCTCCTGATTCGGATGCAGCAA
CCGATGGCAAGGCCAATTTCCGCGGCGCAAGCGCCTCCAAGTTCACGTGGGACAGATCCTGATACGGCTTAAGCAAGCCCAAGTAAAACACCGGATGTGT
GCACAATTTGCGTGGAAGGTTGAGCGTATACGCAAGTCCCTTCTTGGCAGTGACCGTGAATGTTCCAATGAAGCATGGACACAAATTTGTTTTGAAGACA
GCGGACACTACATTTGTAGGTAGGTTTTTAGTATTGAGTAATACTTGGTCTCCGACCTGATAACGTTCAATACAACCTCTGTTTTTAGCATCTGCTTGTT
GTTTTTGTTGATCTTGGCTTTCAGCCATTGCGTCACGCACATGTCTTAAGACATTTAATCGCGTTTGCGAGAAACTCGCCTACCTGTTTTTGAACAGTAG
CAGGGCTGATATCAGCAAGCTGATCGGCAACCTCTCCCTCACCAAGCCCTGAACCACATAGTGGTAGCGTTAACGGAACGCGAGGGTGGGTGAAACCGTT
TACGTAGAACGGAGTATAGCCTGTCGAGGCATGAACAGCGTTGTTCAACGCAAATTCAACAACAGGGAGCATGGAGCTCCAACGCATAGGCGTGTTAGCG
CAAACACTGCACAAAATGTCATTAATGACGCGATTAACACGCTCAGTTTGACCACTGGTCCGCCGATGATCCGCTGTGGACATGTCCATACGGGTGCCAA
GCACCTTGAAGATGGACTTCCAAAACTTCCCAGTGAAGCGAGGATCTCTATCAGAGACAATTACCACTGGCAAACCATGTTGTCGAAATACACGGTCGAT
AAACAGCTTCTCTGTGCCTTCGGCATCAATAGAGTCCGGCACAGCCTCTAGGTGAGCCATCTTGCTCAATCAGTCAACAAAGACCACAATGCCAGTGTTG
GCTTCCGAATCTTTCGGTAGGCCAGACACAAAGTCCATACCATGGACTCCCAACACCCAGTGGGTACAAGCAGACTAGCCAGCGGCGCCGCCGCATGTGC
TGAGGGTTTCACCCGTTGACACGTTTCACACGTACGCACATAGGTGCTAACCCACTTGTATAGTTTGGGCCACCAATAAGCCTGGTTCACTGAGCTATAG
GTCTTCTCACGACCGAGATGACCACTCGAAGCGGTATCATGTGCCTCATAGAGTATTCGATACTTCAACTCCTCATCATGAGGGACATCGATACGAGGGT
TATCCTCAATATCTATGCGATAGCACAACAGGACATTATCGATAGAATATCGATGTAGCCTCGCACGTAAACGTGCCGACAATTCTATGTCCGATTCTTT
AAACTCCTCGCTCCCAAGAGCACGTAGCAAAGCTACACATTGTTCATCCTTGGCATAAGCCGCACGGATTAAGTCAGTGACTGAAGATGACAGCGTAGTG
ACGTGAGCAAGCTCATAGTCAGGTCGGCGCGATAGCGCATCAGCCAAAGCATTTTGCTCTCCTGGCTTATACTTCACCTCGAAGTTATATTCGGCAAAGA
ATGAGAGCCAACGAGCCATTCTCTGAGAGAGATGCGACGAAGGTGTCGCAGTGCGCAATGATGCATGATCTGTATAGATCACAAATGGCTTTGAGCCAAA
CAGATGTACTCTGAATTTGACAAGAGCGTACCTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCCTTTCAGCAGCTTTAGCTGTCGAGATTCGA
ATGCAATGACGCGTTCGCGTCCATCGACATCTGTTTGTAACAGAGCACTGACTATGGCAAAGTCAGATGCGTCACAGACGACACTGAAAGGCCGATCAGG
ATCGGGCAAAGGCAGTATTGGCGCATGAAGGAGACTTTCCTTAACTGCTTGGAAAGCCTCATGTTCGGTGTCACCCCAACACCAATCCACATCCTTCTTA
AGGAGATTGGATACTGGACGAGCCATATCTGCATAATTCTCACTGTACTTATGCAAGTAATTGGCAAGGCCAAGCCACTTACGTAGATCTTTTTGGTTCT
TGGAACCGGCCAATCGACTATAGCTCTTATCTTGGCGGGGTCCGCTCGATGGCCTCGCTTCCCACTGAAGCACCCCAGAAAGGAAATCTCTTCTGCACCA
AAGATGCACTTAGATGCATTTGCATACAATTTATTCGTGCGCATGCACTCGAGCACCGCTCGTAAATGATCAATGTGATTATCCACATCAGATCGACCGT
TCGTTGCACGACTATGCACAAAGATGTCATCAAAGTACGTTTGTGCATAGCCTCGGTGAGGTCTGAATAGTTGCGTCACCAAACGATTAAAAGTAGCCGG
GGAATTTGACAGCCCTTGTGGCATAACGAGCCACTCCCAGAGCATACCGCTCGGGGTACTAACCGCTGTCAGCGGAATATCGCTTGCTCGCATGAGCAGC
TGATAATAACCGTCGACAAAGTCGAGCGCACTGTACAATGTACATACCACCATACTGTTCTGAAGAACATCCTTTCTGGGGATTGGTGTCTGAGCCGGAA
TAGTGGCAGCATTAAGCTTATTATAAGCGTGCACAATACGCCACTTACCACTAGGCTTTTTGACACAGAAAGTAGGTGTGGAATGGGGAGACTTACTCTC
CCGCACCATTCCCGCCGCGTGCTTAGCACGAAAGAAATCGTCAATGACGTCACACTGTTCCTTAGGTAAATGCCACTGCCGTGTTACGCAGTATTTAGTT
ACTGGAACTAGGTCAATTTCATGACGTACACCTCTATCGGAAGGTAAGACAGAAGGTGGATTGTGACACACCACATCTTGAAATTCCTTTACCAAAGGAT
AGAAGGGATCCAAAGGATCTTTAAGGATCCCTTCTATCCTTTGGTAAAGGAATTTCAAGATGTCTCCGGGCACTGAGTGCCGCCTTGGTGTCCTCTAGGA
CCGACTCATCCATTAATGAGGACGAGTTCAACTCAACATCGGGTCTAATGACCACTAATTCAGATAAATCTCCTGCCTTTAAGGCCTGGATAAATTCGCC
ATCAGACATTTCGTCTAGCTCACAAAGAGGATCCAAAGATGGAAGGGTTTCCTGGTTAACATTGCCCTCAACCTGGCCAGTCACTCCGTTGACAAGTGTA
TATAGTGTATCACTATTGTCACTATGTGACTGCACGGACGCCTGGCTCTTAACAGTTGCCACCTGGCGTCCAGGTCTTCTATTCGATGAGACCTTACACC
CCTCTGGGGTCAGGACAATAGTGTCCCCGTGGTTACTACTACTAGTAGTACGCTCTATGCGAGAGCTGATGTTCTTATCGACATCCGGTGAAGTGTTACG
TAACTCGAACACTTCACCCAGTGGATTTAAAAGTGCCACTCCACTTACAATATACGGGACTAGCCCTGAACTTAATGGCGTTTCTCCAACAATGTCATTA
CCGACATTAAGTGTGGTGCCTTCACGGCCGACCACACTCGGTGTATTTTCACGTCCCACCACACACACATCAAAGGAATCACATCCTTGAAAACTCGGCC
CTAGGCTAACCATGCTTTCAGCATGCAATGACTCGTTATCACAACGAGTAACACTCAACGGATTACGTGCCGTATCACCAATATTCAACGAGCTACGCTC
GGAATTCATGTTTTCAACATTAGAGTTAGTTGACTCAGACATTCCAATGTCCAGCACATTGACATCTTCTTTCAAAGGCTCGCGCCAATAATGCTTTTGT
TGCCTAGCAAAGGTGGGTTCATGACTGTCCAAAGCTTCGCTAGTAACATTGCGCGTAGCGCCTAAGGTCTTCGACCTCCAATCAATCCATGGCTCATGGC
GTTCAAGCCAAGCCATACCTAAGATGAGATCATATCTCGAGTCCAGATCAAGGAAAAGACAACGGTCAATGCTATCAAAGTCCAAAATCTTTATAACTAA
GTTCAAAGGAACTTTAGGTACAGTGACACGACTTCCAGTCGCTAAACGAACCGTGATGGAGTCACCCTCATGCGCTGTTAGCGCTTCAGCATACAGCTGA
CTTCCCTCAAGGGAACGACGTCGAGAATAATTGCAAGACGCTCCAGAATCGATTAAAATCGACCAAGACTTTTCAAAGCCTTTAAATTTCGCATCAGCGA
CCAACAAGCCAGCCTTGTATCCACGCTCCATACCAATAGGTATGGAACTCTTTAGGGCTAAGCCCTGTTCAACTTTACCTCCTAAAGGTGTTACAGAACC
TAGTTCTTCCCCAGTAGGGCTCCCCGCGCCTACTGGGTGTCGGCATTTCCCTGTGCCATGCCAGACTTCTGGCTCGGGGTAGAGTGTTGACTCGTAGCCT
GGCGCTGTTTACGCAAAGGGCAACCAGACCGCAAGTGTTTAGTGCTTCTGCACGTATAACACCGTCGTACAACAAGTTGCTGCTCAGCAGCTTGAAGTTC
AACTTCACCTTCGTCTTCAGCATAGCTGAGATCCATCGGTTCTGGCCTATTACCGGCCGGAGTACTTGTGTAGTTTGCTCTTGCAGAGCTAGGGTTGTAC
CCATTCCAGCCAAGTCTGGCCGACTTGAAGTTATGCTCAGCATTAAGAGAAATTCTTACAGCCTCTTCGAATGTAGAGGGGTGAACCCGAAAGGCTTCGG
TTCTGGCAACGCCAGTACGGAGACCCTCCATGAATATAGTCACATGGACTGCCTCAGGCAGAGGGTCAGACTGCATAGCAGCCATGAGAGTTCCCAGATC
TTGGACATAGTCCGTTAACTCATTCTTACCCTGACGGATTGATAAAAAGCGCGAACGCACGCGGTAAGCCTGGTTAGGTGGTGAAAACACCTGTACCAAT
TGTGACTTAAGCGACTCCCATGTGGGAAACGCTAAGTCGACCGACGTGCTACACGTCAAGGCCCATTCTCTAGCTCTTCGATAGAGCTTCGAGATAGCCA
GCGAGACCTGTTGATGGTCAAGCTTGATCAGGCCTGATTTCATGGCCATCTCAATCTCACGGATCCAGAGGATGAGGTTTTCACCCTCCTTTCCTGACCA
GTTTTTATTCCACCTTAAGTAGACGAGGCCTAGCATCTTCGTCTGGAACAGACACATAGCGTGTAGGCATAGCCGACGCCATTTGGTCTTGAACCTGCCA
TAGAAGGGACGCTTCATACTGCAAGAAGCCCTCAACACGTGCAGTAGCACTTCCGGGCCTTGCGATACAAGGAACTCCACATACTCTGGAACCAAAGATG
CGGTCAGCTTATCAAGAGCGACCTTTTGGGCCTCAGAGAGGGGTGTGGGGTTTTCCATCCTCACAGAGGATCAGTCTTTAAAGACTCAGGCGTAGATTGA
CTACAAGTGCTACCAAGTGTAGCGGAGCTGCACAGCTCCTTAAGTCAGAGGAAG