Description :
From Genome Similarity Track
Location :
Scaffold_1:44407- 47025
Sequence
2618 bases(100 bases per row)
CCAGCTCGCGAAAAGAGTCTCTCGACATCGTTCGACGTCGGGGGAATCCACTTCAGGTCACCACGGCTCGGAGCAGGCTTGTCATTGCTGAGAGCGGCCT
CAGCAAAGGGCCTCTTCTCTGTCTGGAGGCCTGGATCGGAGTCAGTAGGAAGAAGGAGCTTGGCAACAGCAGCCCGTTCAGTGCGTGAAAGTTTTGACTG
CTTTCCGGATAGAAGCTTGACCACGCCATTCTCAAAGCCAGGGAACTTGACGAGACTTGCCGTGGGGGACAACCATGCAGCCGTACCAGGGAAATGCTTA
ATCACATGATCAAACAGCAGTCGCACGTCGTGTAGCGACAAAGACTCTGTCTGCAGCTTCTTGTTCACAGCTTCCAGCTTTTGAGGTCCTCATGCAAGGC
CTTCAACGTGACATTGTCACGCGCAGTGGGGATCACGTCTGCAAGCGTGTCATCGTCAACATGCCCTAGAACTCCGTTGATCTTGAAGTACCTTCAATCA
ATGAAAAGGTACTGCTCCATCGTGTTGCATTGCGGAAGACTGGCATCAGCACACCTAGCTCACGAAGCTGGTGTCGGTTCTTAATAGTGTTCAGCTTCGT
CATCAGCAAGTGCAACTTATCCAAGACCTCCGAATGTTCCCGTAGGGTTGCTTGCATAGCCAGATTGAACCGGTGAGAGGCGCAGCCGATCATCGGGACT
CGAGCCTTTCTCGCCACAGCTACATTGACCGACGCATGGTCGCAGACGAAGAAGCAGAGTTGAGACGCGTCGATAGCAGAAGTGTCCAGTACATCGTCGA
GAAGATCAATGATCGAGTTTGAACTCATATCCGACGCATCCGCCAGCGTCGAGAAGCACAGCAGAAACTTGTCCTCGGGCGTCCAAGCGATGACAGCAAT
AAAATGCGTGCCGTCTACCGTCCATGCATCGATACCGAAGCCAATTTGCTTTCCGCACAGCTGCGACTTGATGCGGTCTTCCACAAGCTTTTCAACTCCG
GCCATGTGTTTTTTCAGCGACTTCACGCTGACGGGCTTGAGGTTCGTGTCCTTCCTGGTCTTGCTTTTCTCGCACATGCTCAGCTCCCGATTTTCCATGA
TGATCCAGTCGTGCCAATGGTACATCGTGAGGGAAAAGTCGTCTGTCTTGACGAAGACGTCCAGGCTACCCTCTCGTCGCTGAACAGCACGAAACTCGTC
CTCGTACGTCCCTCCATGACGGCGGGGGGGGGGGGGGTCGTGTCTCCTCGATTCCCGCTATTAACTCCCAGAGGTTTTTGAAATCTAAGTCGTAAGTGTT
ACGACATTGTGAACAAATCACAATTCGGAAAGCCAAAACTTACGACTTTCAGACTGCAACGCACATTTGTTTTGTTTGCAACAGATCCCTCCTTTCTAAT
CCATAAAGATCCGGGCGCATCAAAAACTGTACGAAGATCAAGTAAATGCAGTGCTACCCAATCCATCTATACGATTGCTGACTGTAGAACATCCTGGTCG
ACAAGCTCTTCCGCCTCATTATCAGAGTTGCCATCTTGACAAATCAGCTCTCGTCGCGTGGACTTATGTGCACCCACCTTGCCTGAGCGCCGCAAGACGA
CGCGTTTCCCGAGGGGTGCTGGGATGGAGACACCACTCTCGAAGTCTGCATGCAAGATTTGGTAGCATGTCTTTCGTACACCCCGTAATTATGCCGCGAT
TTGGGGCATAGGAAGCACTTGGCACCAGGCTGTGAACAGTCTTCACAGTAGTAAGTGGTCTGAAATGACTTCTTTCGCTCGCCGCGGAGAAGAGCGCAAA
CTTTACAGGAACGTTGACGGCGTTTCTGGACGCCTGATACGATGACCCAGTCGTCAAACTGCACATGCGCGTGACCATCTAGTCGGCGGCGCTTCGTGGA
GCGCGCCATAAGGAGAAGGAGTAGGGAGCAGAGGCGTCGACAAAGTCGTCTGCCGTGAGCTGCAGTAGTTGTTTGTGCAGGAGGATATACCAGTCTCCAC
GGTCTTTAGGTTACGAGTCGCTTGGAGCCGACACGTTTCCGTCTGTGTGAGGTATGCATTCACCCAGTGCCATGTCTAGCAAACCCCATGAACAGTGATT
TGTAGTCTTTCTGGAATCGGAACGCTGTCTGAATCGAATACGACTGGAGGCGGAGTTGATCATGGACATCAACTCCGCCCATCCCAGCGTTGATAGTCGG
TAACGAGCTTCGGGCCTTAAATGTTGACGGTCCTACCATCTTGATGTTTCTATAGATTGAGTCTTCTACCATGGTCGGACCCGTTGCTAGGTAGTGTACA
GGTTTCCTGTCCCACCAATGACAGGCAATCATGGTCGGAATAGCATCTGACCGCGAGAACGCGAAGGATCCCCGTTCTATCGCACGCGGTCTTGCTTTGC
GTTTCTCAATGACTTGCTTATCAAATCCTAGCCGGTTAATCATGATCGTCCCTAGCACGTAGACCGACATCGATAAAAGCTGTATGGCCAGCGGTATCGA
GGAATAGAACCGGTCGATTACAGCTAATCGAAATCCCGGAGAGGCTTCACTCAGAACAGCCTTCATGTTTCGTATCACTGCTGCTGCCCTCGTCTTGTTG
TCGACCTCTTGTTGGTCC