Description :
From Genome Similarity Track
Location :
Scaffold_115:44398- 45866
Sequence
1468 bases(100 bases per row)
GCTTGAACGGTGGCGAGAGGGCGGCGTTCCTGGGATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGACCGCGAATTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCATTAAAAA
CGAAAGCTCGGTAATAGCCGCAAGCTTCTTTGGATAATCCCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTTCACCTTGGGCTGGCAGAAGATG
CTCTTAGTGAAGCTAATGCTGATCCGACACTGTGCAAATTTTGCCAGCAAACGGTCCAGTCTCGCCAGCAGCTGTCGAAATCCTCGCCACCAGAGCAAAT
ATCATCCACAAACGATCGTCGTCCAAACACAGGTACCAGCGTAATTCATCTGGTTCCCCGTTCGTAAACATATCAGCGACGGGGCTGTTGACGAGTTGTA
GTACAGGGTCGGCCTCCACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGTGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTC
AGCTAAACGCATCCTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGTTGGTAGACCATCGGCGCG
TTCTTTAACCCGAAGGTCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACAAACGCCGACACTTTACGTGCTCACAAGGTCTTCATGACCGCCCACA
AGCCGCTTGTAGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCGGTCAACAGATCGTCGACTAGCGGCATTGCATACTCCATGATTGCGGTGAT
AGCATTCACCATCTTGTAATCAATGCAGATCTGGATGTCCAGCCCGCTCTTAATCATCACAATCACGATTGGCGATGCCCATGGACTGTCTGAAAAGACG
ATCAGTCCTGCTCGCAGCAAAGCGCGCAGTAGCTCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCTGTTTAATTGGGGCGTGCCCCTCTGT
GTCGATATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCT