Description :
From Genome Similarity Track
Location :
Scaffold_13:443961- 447829
Sequence
3868 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAGCGGCCACAACCACCTCATCTGACATGAACATGTTGGATGAAGAGGAGAGTCTTCACGCCGTGAA
GACTATACCCATTTGAGTGACATCGAACGGACTGCGGTAGAAGGTATGAGTTCTACCGTAGGCGAAACCGCCATTAGCGCCATGTTGGAGTCTCTTGACA
GAGATCAACAACATGCCGCTATAGCCAGGTTCATTCAAAATGAACTTGTCTCCGAAAGAGTGAAAGTAGCCTTGCTTCACCAGCAAGGCTCTCAACAGGC
CGAGCAGTTGAGAGAACTCGGTGCTCAACAGACAGATCTGTTAAGACAGCATCAATTCAATGCTGCTGTGGGCGGGACGACACATACGCGTCGTCCCGAA
ATCTTGAAGTTTGATATCTCCAAGTACAGAGGATTCGAGGAAGACTCCCTGTTATTATGGTTCATCGAATTAGACAGAGCCATAAAGGCACGACGTATCG
ACGATGAACAAATGAAACTCACATTTGCTCAAACTCATTTGGCGGGACGTGCCAAGACTTGGGCCTTAGGGCTGGAGATGAGCGACCCATATGCTTTTGG
GTGACTGGAAGCCTTTAAAACTCGACTCAACAGACTTTTGAGCCTCCACGGGCTGAGTTCAGGGCTCGATCAGGGCTTCTGAAACTCAAGCAGGGTAAGC
GTGATGTGCACGCTTACGCTCAACATATACGACTGCTTGCGAGTAGTATAGTTGCTAACCCAGTACATGAACACACGTTGATTACTGTGTTCATACAAGG
GATAGTAGACGGGCCCGTCAGGAGCCACCTGTTCCGCTTAGAGTTGGATACGCTTGAACAAGCAATCTCAGCTTCGGAACAGGAGGACTTTAGCATGAGA
CAGGCTCATGCTAGCTCGAGTTCTTATCGTCCACCGAGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGATATGTCGAGAGCGAGAGACCTC
TCTCTTCGAACAACAAGCAATTGCAGAAGTGCAATCGCTGCCAGAATTCGGGACAATACGCTTACGAGTGTAGTGCCCCACGCCCAGTTCCAAACAGTAC
AGAGCGAAATGATCGGCCAATTTCCAGAAAGGATAATGGGCGTAGGTCTAACGCTGTTGCGAAACCGCAACAGCGAAGTGGACCATCAAAAAATGGTCGG
GATCAGTAGGGGCGGAGCGCCCTACTGATCCAGCAACCTCAAGAGAATTTGCAAATATCTTGACGAAAGTTGATCCAGATACACAATCATTGTGTGTCTC
TGCACCTGGTGATGAGGTATCACTCATCACCTTGTAATTAAGTGACAAATGATTTGTCACTTCGTGCTCTAGTCGACTGTGGGGCGTCGAACAACTTTGT
TCGTCGTCAGTCGCTAGAGGGTCGTAGGCTCAAGTTCGTTGAGCGCGACATCCCTCAAACGATGATGACGGTGTGACTCGCCACAGGCGCGTCGATAACC
GTTGAGAAACGTGTAGTTAGAATCCAATACACGTTAGAAGGTGAACAGTACGATGACGATTTCATCGTACTTGATCTGGATGACAAATTTGATGTCATCC
TGGGATTACCTTGGCTCAGAAGATACGAGCCAAGAGTGAGCTGGCAGCATCGATCCGTGAAGATGCCTGCCGCTTGTTCATCAGATGGCCATCTGATGAA
CGTCATGGAGCGTCCACAAGCGTGTGGATGCACTGCGAGTGAGTGCTATGGCCTCACTTGCGGTACGGTCGTTAGCACGACTGTGTAAGACCTCAGTGTG
GCTGATTCCTACACTGTGGAGCAAACTCCCGGCGGCTATACAGAAGTACAGGCAGCGCCAAAGGTCCACCACTCGAATAAGTCGAGTGGACCGGGACATG
AATGCATGCCTAGCGGGCAACATACTAGGAAGAAGAAACCGGTTGCCACCAAAGGGCAACACGGTCATCCTAGGTCGACTGGAGAGTCGACCGTAGAGGA
TCGGTACCTGACTGTGGTTGCACAGCCACAGTCAGAAGACGTCGAGAGAATAAGTCCCCACGTACTTGAGGAAAGGATTCGTCAAGAGTTACATGCTGAG
AGAAAAGGCTCTCAGCAACCTGAGATAACAAGTTCCCAGGAAGAAACCGAGACATTGAATGTCTTGGTCAATGACGGATCAAGCGTAGGCGCTTATACGC
TTGATCTGATTGTGCCTCCGAAGTTAACTTCGGAGATAACTCAATTGACAACGCTGGAACCGAAGCGGTTCCCGTGTGATCTGCGTAGTGGCAAGGTCAA
GCAGATCTGCATACTTGTCACAGAGGATGAGTATGTGACCGATATTCGGTCGGGCAACATTATTTGCTGAGAACGAACGGGTTCTCAGCAGCTCATCGAT
GGACGAAAGTGTCCTCGGTGAGAAGACTCGGATTGAACGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAATCCTTTGTATAAGGATTTGATCGAA
TTAAAGGATGTGTTCCCTGAATCCGTGCCATGCGAGTTGCCTAATGACAAAGGCACTCGACACGATATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCA
TGAAGCAGTGGCCAATGCCTCGTGAACAAGTACTAGCGATCGACAAGTTCTTTGCCGATTGCTTTGCAGCGGTCCATGTGAGGGAATCCACTTCCCCTCA
CAGCTCTCCGACCTTCTGTGTCCGAAAAGCCACAGGAGGATGGCAGATAGTGCACTCATTCAACAAGTTGAATGCCGCAACGGTACCGGCTCAAACGCCG
ATACCGAGGAAGGACGTAATCATAGATGGTATGTCAAAAAGTACCATCTTTTCGTCCATGGATCTGATGGATGGCTTCTACCAGATCCTAATGCGTGAAC
GGGGCATCCCGTACACAGCAGTGATCACCCCCAGCGGTATGCTGTGGGAGTGGCTAGTGATGCCACAAGGGCTGAGTAACACCCCTGTAACGTTCAACAG
ATGTTAACAAATCTGTTGAGACCGGTGCGGGACTTCGGACCGAGTTACTTTGACGATGTGTTCGTCCGTAGCCGGGTTATGGATGGGAAGACGGACGTGG
AAGTTCACAGAACACACTTTCGTCAGGTTCTTCAACTCATGCGGAAGCATAAGTTGTATGCCAACCTCAAGAATTGTATATTCGCGGCTAGCAAAATACC
ACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACGCCCTGATCCCAAAAAGATCAAGGTAATCACCGAATAGCCTGATCCAGTCGATGTCAAGGGATTA
AGAAATTTCCTTGGACTAGCGGCGTATTTTCACAAGTATTCGCGCGATTACGCCGAGATGACTGAGCATATTTCTTGTCTACTCAAGAAAAATGTGAAGT
GGTCATGGAACGCTGACTGTCAGAGTTCCTTTGAACGTATCAAGCAGAGCTTGATGCGATTGCCCATTCTGGCGATTGCAGATCAGGACAGATCATTCCA
CGTGGTCTGTGAAGCCAGCGATTTTGCAATCGGCTGTGCGTTGATGCAATTTGGTACAGATGGCGCAGAGCGCGTCATCTACTATCAATCGCTTCAGCTG
CAAGCAGCTGAGCGTAATTACCCAGTGTATGACAAGGAACTCCTTGCCATGAAATATGCACTGGCTAAGTTTCGTGTCTATCTCTTGGGAGATAGACCGT
TCATCGACTATACGGACCATGCGTCCCTACGCACGGCCGTAAACAGTCCACACCTCTCGCAAAGAATGGCGAGGTGGCTGTCCTTTTTCGTGGAGTACAA
CTTCTCCGTCGAGTACAAACCAGGACGACTGAATGTCGTCGCTGATGCGCTTTCGCGGCGACCCGATT