Description :
From Genome Similarity Track
Location :
Scaffold_89:44390- 45980
Transcript NameFunction/comments
g6799.t1XP_009514982.1 hypothetical protein PHYSODRAFT_293464 [Phytophthora sojae

Sequence
1590 bases(100 bases per row)
CTGAAAACCTTCATGCAAATAGTTTTGTGCTTGTTGGGTGGCGCTCCGAAGATCAATAAAGAGCTGGCTCCGGTTACTCAAGATACGCGAGCGTTGATTT
TTAATTTGGCGCCTCAAATTCCTCAACTCCGTACGCCGCGATAGCTGCGCCTTCGCCGCAGACGCACCAGCCAGCGCTGAGCCATGCGACAATCGAGCTT
CGTCGACGAAAGTACCATTCTGCAAGAAATCAGAGGTGGAGGGGTCGATTCCACTGCTCCAGATGCGAGCATTTGTCGAGCGCAGGATAATACTATCCCG
TGAGAATGAGCTACGTGGTAGGGAAAATGCCAAATCATTTGCGACGACTTCAAAGCGCACTTCACCCATTTGGCTTCTCGATATTCCCATTGCGGCAGCG
CGCTCGTTCACCTCAGCCACCACCGTGTCATAATACACACGTAGTACTTCGTCCACTGAAGCCGGAAGCAAACCAGTGTTTACCTTGAAGTGTTTGAAAA
TAACATCTGCCTTACCACACGTCGGATTCGCATCCAATGGATTGGCAAGACCTACGAGGATGTGGTCAAGTACGTAGTGATGAAACTGCTTGTAAACCCG
ATGCAGATACACTACGCAGACAGAATCCAGTCGCACACGCACAATAACACCCCCTTCATCACATCCACTGGCACTTGTCGATGCGCTATTTCTCGAGTAG
ATGATCATAAAGTCGATGACGTTTTTCACTCCGAACGACCCAACATCAGCAACTCCGTCTAACATGTCAGAGGGAGAACCAATGGCTTGCCGATTTGGTA
GCGTTGCATTTGCCGGTGGTGCAGGGCTTAGATCTGTCAAATCAGTCAGCTGCAAATTTCTTACAGTACCTTTAAGTTCATATTTTCTGTCACACACAGC
AGCACCAGATCCACAAGCTTGCAGTGATACACTTGAAACCTCTGCTCGTGCGATTGTCCTGATGGGGGCAAAACCATCAATAGGGACACCAGGCGATTGG
TCTCGGTGCTTGATATCAATTTGAAATCCATGAGCAATAGACAAGTTCGCGACAATCTCGTCCTCAAAAGACGATGAATCCTCCAACAATGTTGACGAAG
CTTGAGATCCTAATTTTGACAAATTGCGCCGAAAATCGTCAAGCTCGTATCCGAAACTAGTAGACAAAATAAAACCCAGCAAATATCTGTCGTGACACCC
TCCAATCCATGCCAGCACCGTTTGCACGTTCGGAAGGAACAATTCTCCATACAGGTGCTCGATAGAAATCACAATGTGGGTAACTTGACGATCGAACTGC
AAGGCTGATAGCACACTACCTGTTGTCCGCAACTCGTTGGAGTACATTCGATCCATCTGATACGTGGCACAAAGAGCAGGCGTGCGCAAACCTGAGCTTC
CAGCGACTTGAACAATAACATGTTCATCTTCTTGAAGCGAAATTGATGCTACAGTAATACCCTGGGAAAAGGTCGTTGTGCATACGCGTGACGACCAGTC
CACGTCCTTGATCGAGAGCGTAAACGACGCCAGCGCACCCTGATCTGGGCGGTCATCATTAACACAAAACTGAATTTCTGGTGTCCGAAT