Description :
From Genome Similarity Track
Location :
Scaffold_3:44381- 47101
Transcript NameFunction/comments
Physo_127805hypothetical protein
Physo_127806hypothetical protein

Sequence
2720 bases(100 bases per row)
CGCGGCGTGAAGCCACGTAATATCTGTCTTGAAAGTGCAAACGCGAGCCTCCATGACAACGATGATGGTAATCCGATTGTCATCCACGAAGAACCTTTGC
CTTGGCTTGTGGGTTCCGACCACCATCTACTGTAGACGAATTTGGATTCCTCGTCAGCAACTACACCTTTGCCCGGCCATAGTTGGCCTAATTTGCAAGC
AAAGTTGTCATGAATATTGGAGGTACCAGAGAGTAACATTACATTCCCTAAAGTATGACTTTCGTTTCATTCAAAGTTGTCTAATTCCCACCAACGCCTT
TGGCGTACTCTGATAGAGTGCGAACTTCGCACTGCGAAGTGACGCCAGCACAGAGGCAAGATGGCGAAGGCGAAGGCGTGTGTGCGTGCGTGCAGCTTCT
TGAGTGTCCGATCCGCGTCTGCATGCCCTTCATCAAGCGGCAACTGTACGCGCGCGATCTCTCAAGGAGGGGAACATGGGGGCGCGTTGAGACCGCCCCT
CACTGAGCAGGGGGTGAGACGTGCTTTGCGGCTACATGTGGTGCATGTACCTCTCGATGGGAATTAGAGAACTTTGAATGAAACGAAAGTCATACTTTAG
GAAATGTAATGTTACTCTCTGGTACCTCCAATATTCATGACAACTTTGCTTGCAAATTAGGCCAACTATGGCCGGGCAAAGGTGTAGCGCAACAGCCTAG
CCCATATACATTGCGGTACCTAGCAAAACGAGACGATTATTAAGCAGTTAGTCAACTTTCTCTGTCTTGCGGCTTCCAGTCACTCTTGAACGCTATCGCG
TCGAATTCACGAGTGTTGCTACGAGGAAATCTTGCTTACCGTGACAACTCTGACCCCGTCCAGGGGTTGATCGTCGAGACTGGGTCCTTCACCTGCTCCT
TGAATCTTCGACACCGACGCCAAACCTGAGTGAGGGGAAGTCGCGGTATGTAACCTTTCGAAAGTTTTGAGCTCGTGGCATTTTAGTACCCATCGTGGCA
TTTTAGTAAATGAGAAAACTAGGAGTGGCATTTTAGTAGTTTTCCCTTACTATTTTTCGTTGACTGTGGTGGGTTTCGGCTCGGAGCCTATCCACGATGC
CTTCAGTATCAATTTAGGTTCCGACGCTGACTGCATCACGATTGCTGTTTCCGTCTCCATCGCTTCATTGAAGTTTCAAACCGACGGATGAAGTATGTGT
CGCTCTGTATGACGTCAAGCGGTTCCACACGCAACAGATACAGCTCCTTTGTTGTATCAAAACTCAGGGCCAAGTCATTGTGTGCGAATCGCGCATCGAC
GATGTGTGCGTCGTGCGCCAGGATATTGTCATCGAAGAACATGGCGTGGACGCCTTCGTCATCGTCGGTTGGATCCAGAACCAATAGCTTCCCAGCAGTG
GCGTCTTCCTTATTGCGGAACCAATGCGGGTAGAAGTCCCGCAGCGCCAGTGTCGCCTGCGAATCACGCCAGCGTCGAGCTAGAAGGTTGTGGATTTCGG
ACAAACCTTGCACAATCTGAACTTCTTCTCCATGGGGAGCGTAGAACGCTAAAGGATCCACATCATCGGCAGTTTTGGGCTGCTTGAAGGTGCCCATAAC
AAGCGCCGTGGTGCTTTCTGCTCGCAAGAACGTCCCAAACCTCGGCATTTCTCCGTCTGATTCTTGATGAAGATGAATCCGTCGGTCGATTCCTTCATCC
GATCCATCCATAGCTTTCTCCAGTGGAAAGCACGGATGGCGCCCTTCACAAAAGCAGTTGAACTCTTGCGCCACGCGATGGAGGTCATTTCCATAGGTCC
GGAAAATGAGGTTGAACTTCACGTCGTTCGTCTGCAAATACTCCATCAGCCTGAAGAAAGCTGGCACAATGAAGCAGTAGGGGGACTCTTGCAGCCCCAC
TTGTCCCAGCTGTACCTCAGTCGCCGCCGTATCAGGCAGCAGCAAGTGTTGCAGCAGCTCTCCGTGTTCACTTGCCAGTCCCTCCCCCGGGTTTCCTTTC
GCCGTGAAATCTTGACGCAGCACCTTCCTCATGCGCTTGTTGTGCTTGGCAACCTGCGGGTCTCCCGACAAGGGGAACTGCATGGACAACAGTGTCACCC
CTTCAGTTCCACCAACCGCCGACGGGGTCGCCCCCAAAACACCCCCACTACATTCAACCCCACCTTGGCCCTTAGAAACGATCCATACGACACGAGGCCG
TCCGTACCAGCCCTCGTCTCCGTAGCTGTTTGCAGCGCCTTCTCCCCGTCCCAGACCCACTTCGTGTCTCCATCGGGGGCGTCCACCACTCGCCCCAAGG
CCCGCTCCGTCAGCAAGTCGTTGAGAATATGTAGCAGCGTCTTGCCCTGCACGGGGTCGTGCATGATCACAGTCTGCCCAATGCCGTACACCGTTCCGTC
AACAGATAATGAACGATACAGAGAACTCTACAGCTGCAGCGCACCTTGTTCACATCGAAGTACAGCAGCACGTGCGGCGCCGCCGCCGCCATTTTAGCCT
TGGATTCGTCACTGCGAATCCAAGCGTACTTTAGAAATCCACACACCGAAATATTGCGCACTTAGACAAAGTGGTGTGTACCACGCCAAATACCGGCCAT
CGACAGACAAGTATGGCGGACGCGTCGTCGCCGCTGGGGGCGCTGCAGGCCCTGCGCCAGCACCTGATCGCGGGCAAGCCCGTGGCCGTGGACGGAGACG
ACCTGGTGTTCCGCGATGCG