Description :
From Genome Similarity Track
Location :
Scaffold_1811:4436- 5573
Transcript NameFunction/comments
Phyag_g11528hypothetical protein

Sequence
1137 bases(100 bases per row)
CCCGCCGCAGCCGTTGTAGACCCTGGCGCCACGTTCCAGACAAGCCTCCGTAGCCGGAACACCAACAAGGTGCTGAGTTGCTCCGGAACTGAAGTGTGGC
GGGACGTCCCAGCTCACGGGAACGATCGGAGCACCTATGGAGAGCGAAGTCGTAGACGCAGGTATGACGCCAGGCAGACAGATCCGGTCCGCCTCTGCAC
GTGACAGGAAGTGACCACCTCCGAGCACTGGGCTTGGAGCAGGCTGCGACGACACCGAGGAGCTCCGAGAACTGCGGTTGCTGGCTATGCCTCTGGCCGG
GTTCTTCGGGAACGAGTCCCCAGTGCGTTTCGCCTTTGGGTCGTAGCCCCCCGACACTGATGCGTCTTGTCTTAGCGATGTTAGCGCCGCCGGCCTGGCT
GGTGCCTGCCTGCATGCTTGGAGCGTCGCCGCCGGTGCTTGGAggggcgctgctgctgccggcaCTGGCTACGGGTGGCTGCGAGCCGCCGGAAGTGCTT
GATGCGTGTgcgccgtcgtcaacagGCGGCGGGGCGAGCGTAGCGATGGCCATCTTGTTCAAGAGTCTGAATCGATGATTGTCTGATTCGGAAATgtcag
gagctggaggtgtgCCACGCACTAAGTGCGAATGGTGGTTGCCGTTGTGGAGTTGCGCCAGTTGCAGAATGTCTGGGATGCCAAGTCGCAGAAATGATGT
TGGAAAGGGCGGCCGGCCCGACCCAGAGTGTCTCGTTCCAGACCTCTTGGATCCAGAGTCCGACTCGGGCTTCCAGTACCTCGTAGTCCCGGACATGGCT
TGTCAGTTTGGAAGCAAGTTCCGCAATAACCAGTCATGGCCAGGAGGGGCGGttgacacgaggcagtttcccacattttgggacagccgattttcagttg
cgacagtggagtttcggagttttgattggtggatgtggagtggatctattgcgacattttgtggaaagagtgcgtggtttgaattgtgagcgtgtggaga
gccaaggatgggcccttaggttccggaagcgcgtgttccagagatgtacactctgaaacgcacatgcgctcagTCCGGAACCGCCCACGTCCTGAACACG
GATCGCTAAGTAGACGCATAAAttgtctgcacgaacg