Description :
From Genome Similarity Track
Location :
Scaffold_29:443219- 444244
Sequence
1025 bases(100 bases per row)
TGTAAACCTGAGTGGTATGCCTCTGGACTACAAGAAAACAAGAAAGGAGCATTAGTAAGGACCCTAGCCTATTTGCGTTCAGTCTAGAGATCTAACATGA
GCGATGAAAAAACTCTACTCTGCTGGGTTCATGGTCTCAGTTCTACAATGTAATTATGTTCACGCTTTACCCGAAGAAGATACTGCCAGCTCCGACTAAG
ATATACGACTCAAAGCCCAAAACGACAACGACTTCAGCCGTTTGGAGGTCCAATTAAGTGCCGATACGGAATACCTTCCAATGATGTTATTGATGCGCTG
TCAGATGCCAAATACAACCGTGATAAGCGCCGAATTTATTGGGCTTGATTTTTAAAGGGTAAAGGTGAAGCCGCACGTGCTTATTTCCAAGGGAGACTGC
GATAGGATCGCAATCGAGTCGAGAAGCATCTGGAATCGGTTGCACTTCATGAAGCCAGTTTTTATGAGCGACAACAGAAGGTTCAAGCAGCGCGAGATGA
GGATTCCGCCAAGAGAAAAAAACTGGAAAGCGGAATAGAAAAAGGACCAGTTCACGACTTACGAAGAGTTCAAGGAATTGGGGACAAAGCGCAGGGTCCA
ATCGTCCGCCGAGAGTAGATAGAGTAGGGTGTAAGCCCCTTACCACATATGAATTCTAAGACTACGCACCAGTAAAACACTTCCAAGCTCATACGGAAAT
GAACAATTTCATAAACAAAACATACGAGCTCATACGAAATAGTACGATGCGCTCATACTAACAATTACGAGTTCATATTAAAAGGTACGAAAACGTCAAA
CTTAAATATGCGAGTTCATACTAAAGCCTACGATTAGCCTATGACTTTCTCCTTACAGGGAGGTGTTTACTCAGGCACATGCTTCACAAGACAGGACTTG
TCAATGTGCTTCTTGTGATCCTTTTTAATGAAGGCAGCTAGCATGGATATTGTGATCGACATGCTCGACTTAGAAGCGTCAAGTTCTACGAGTACTTGGT
GTAGTAGCTACAAACACAGGTAGGA