Description :
From Genome Similarity Track
Location :
Scaffold_1970:4432- 5566
Transcript NameFunction/comments
Phypl_g14476hypothetical protein

Sequence
1134 bases(100 bases per row)
CCCAAGTAGGCTCGTCATAGCACACCCATTTCACCTTGAACTCGCGCACCGACCTCTCGGTACTCGTTGCAAACGGTGTCCGGTCATCGAGAATCGTCTC
AACTTCGTATTCACCTGCAAGCTGGTCTGGTACCCAGCTGTCTTCTGGTAGTAGTTCTTCATCAAAGTCAAGTCGTGAGACTTTGGCTACACCGGGGGCC
AGGCGAGTTGTCGGTCTGCTACCGAATTCGCTCACTGGCTTTAGACGGGAGACATGAACTACAGGGTAGAACCTGTAACCCCTTTTAtctggcagctcga
gctcgaatGCGTACTCCTCGATTCTCTTCTTGATCCGAAAAGGGCTATGCCACCGATGAGCTAACTTCTTAGTAAGCCCAGGTTCGACCCGTTCCATGTA
CAACCAAGCACGACTGACCGGCTCAAACAGAGACTTCGGTGCTTCGTTTGGATGATCAAGACTTGCTTCCGAGTTATCGGGGCCAAGTCCCGAAGGCTCC
CGATGGTTCTACGCGGGATTGTGGCTCGTTCCTTCCGGCTTAACGCTTCGTTATgttcacgagctcgtcgatcCTTCTTTGTCGCTTGATATTCCATAGC
CATTTTTAACGCAACCTCATGCTGCCGGTTGACTTCACGTCGCCACGCCAGGGCGTCCGACTGCTTGCCCGTACCTCGGCggatggacgacgacataGCC
TTGAGCGTGGATTGAGCGTCCCAGTCATGGACCAAGTAAAATGGCGTCTCCTTCCTTGTCGCGTCTTGCGAATTGTTGATTGCGAAGACTAGTCGTTCTA
CGATCTCATCCCagtcctgctgcagcgagtcgtcGGCATAAACTCTCACCGACTGCGTCACCGTCTTCACCGATCTCTCTTGCTGCCCGTTTGCTTGCGG
CCGATAACTCAGAGTTGCTCTCGACCGGGACTGCATCATCTCTGCAAAAACTTGAAACACCTCGCTCATAAAACGTGGATCACAATCATGCCTGATCAGG
GATGGTGCTCCAAATCTTCGGTATACACATTCTTCAAAGGCCTGGGTCACCTTGAGCGCGGTCGTGTCCGACATAGCCTTGGCGGTCACAAATCCAGTGA
ATGAACACTGAAACAGGAACAGTGCCGTGTTGCC