Description :
From Genome Similarity Track
Location :
Scaffold_9:443051- 446225
Sequence
3174 bases(100 bases per row)
ACTTGGACAAGTATCTGTGGTACTGCTCCCTCGACATGGCGAGCGGCTTCTGGGTCGTCCCCATGGCAGACCGGGCCCGGCTCACCTCAGTCTTCATCAC
GCCGATGGGACTGTACGAATGGCGGCGTATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCGACAACGCGCTCTACGGGTTCATG
AAGCTGTCCCCGGATGGCAGCACTCGGGATGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGGAGGTCGTACATCGACG
ACATCCTCATCGGGGGCACGTCGTGGGACGACCTGTGCGAGAAGGTCGAACACTTGCTGGATGTCTGCGAGCAGTGGCACTTGTCCATCAGTGTCGAGAA
GAGCGAGTGGGGCATGTCTAAGGTCGACTACCTGGGCCACCGAGTCTCAGGACGCGGTCTCGAGGCGAAACCGAAGAATCTGGAGTCGCTGACGTCGCTC
GAGTTCCCGCGCACGCTCAAGGGCCTGCAATCGTTCTTGGGTAGCCGCAATTACTACCACCGGTTCATTGCCGACTTTGCGGTGTACGCAACCGCGCTGT
ATTCGCTGACGGAGACCGACTTCAGCGAGTACGTCACGGATCCAGAAGTCCGCGGACATGAGAAGTGGACGCACGCGACGCGCGCCTTCGACGCTCTCAA
GGCAAAACTCGCCGAGACCCCAATGTTGAAGCACTTCGACGCGAACCGAGAATCCGTCGTTATCGTGTACGCCAGCGACTGGGCCATCTCAGGGGTGCTC
ACGCAGGTCCACGACGAAGTGTACATGCCTGTGAAGTTCACCAGTCGTACGTTGAAGCCCAACGAGCTGAACTACGACATCGTCGAAAAGGAGATCTTGG
CCCTGTTGCGCGTCATAAACGAGTGCTACACGATGCTAGCAGTGGGACTGGTCCGCGTCTTGACACGTCACACGACACTCGCCTGGTTGTTCCGGTCCAA
AGGACTACAGGGGCGACTGTCACAGTGGGCCGCGATCCTCTCGCCGTGGAAGTTGGAAATCTGCCGATCCATGAAGGGAGAAGAAGAACTCCTCGGCGCG
CTGGCCGCGAGCATTACCCCGCGAGCCTTCGTCGACGCGGCGCTAGACGAGATCGCCCCACGGAGACGGGCGTCCAGGATTGTAGTCATTCCAGTCCCCG
ACGTGGCGCGCGACGATGTCTTGCACGTTTTGAGCTATGACGGATCGGCCAAGGCGAAGCGAGAAGGCGGAGCATACAGTGCCGTCATTTGGCAGCTGCC
GAACTGGGAGATCGTGCGCGTCGCGTCGGGATATGCGACGGACCTCACGGTCAACGAGGCGGAATACTGCGGGCTGCTGCTCGGATGTTCTCTTCTAGAG
GAGCTCGACGACGTCACCCGACTCGTCGTATGCGGAGACTCCAACCATGTCATCAGGCAGATGCGGGACGAGATGGACTGCAAGTCCCCGGGGCTGAAGC
AGCTGCGAGAAAAGACGCGAAACGCACTCCAGGCATGGCCGCGCCGCGAACTCTTCCACGTACGACGAGACTGGAACGCGAGTGCCGACATGCTGGCTGG
ACAAGCTCTGCAGCGTCAAGGAGGCCGCAACGCGCACAGCCCCGAAGAGATTTAAGATCTGAAGACGCTGAATCACTTGGAAGAAGTCATCCGACCACGG
GCATCGAGTCCCGGGATGGCGTCTCCAGCCAGTCCCGACGCGGATAATCTCGACTCGGAAAACCTCGACTCGGAAAATCGCGACGCGAAAACGCGCGGCG
CAAATGACCCCGCCGGGAAGGCCATGGACGCGGGGCGCGGGACAGCACAAGTCCTCGCTGTGACGACGCGATCGGCTGCCGCACGCACGACAACACATAG
GGTCCGACCTCCAGAAGTCCTGGAGGGGCTGCTGGTGCAACGACTGCGCCTGGACGCATCCGTGTCGCCCAGGACGAAGAGGTCTGGATCGTCAACCTCA
AGAAGTATCTCCGCGGCGACGTCGGAGACCTATCTCGGCGCGAGGTGAAGAACTGCCAAAAGCTTGCGCCTCAGTACGAAGAGGGCGAAGGCGGGCTGCT
CTACTACCAGCTGAGAAGCGATAATTCCGCCGAGGATCGCGATGTGATGATGAAGCTGGTGATCCCGGAGACTCTTCGGGAAGATGTACTCCACCACTAT
CACGCGAGCCTGGAAGGCGGACACCAGGGTATTGGCCGCGCGTGAGGCGCCACTTCCATTGACCAGAGATCTTCAGAAGCGTCCAGCGCTACGTCGGCGA
ATGCACCGACTGCGAGACGGGAAAGGGTCGGCCGACCATCCAGGGAGAGTCGCCGGGCAACATCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGAC
CATATTCCGTCGTTGCTGGCATCCTACAATGGCAACTCAGAGCTGTTAGTCTGGGTCGACCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAATGCGTCAC
GAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCGAGGCTATCCGCCACGACCGTGAGCCGGGCTTCATGTC
CGACTTCTTCAAGGCGTTCAGCAAACGCATGGGTCAGAGACAGCGAGCGACGCTTGCTTATCGTCCCCAAGCCAACGGTGCTGCAGAACGGATGGTGTAG
ACGGTTACAAGAGCAATCAAGATGTACATCGCAGACGTCGACCAACGCGACTGGGACGAATACGCCGAGCGTCTTACCTTCGCGCTAAACACGTCGCATG
ACCGGACGAGGAATGAAACCCCGTTCTTCTTAGTGCACGGCTGGGATCCTCGGTCGACGCTGGAAGCGACGCTGGCCGTCGGGAACACGTCGACCCGGGA
CGCTGAGGCGAGGCGGTGGAGGCTCCGTATCCAGCGACACTACAAGGTGGCAAGGGCACAAGCGTTGGAGTTAGTCCGAGAGGCCGTCGAAGAGAGAGAG
CGTCGACAAACTGAAAACGCGACATGAGATCGCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCGGGGTATGCGCGCAAACTTGCGCAC
ATGTGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCAGCGCGTTCGCAGTGCGCCTCGAGACGACGCGTACGGA