Description :
From Genome Similarity Track
Location :
Scaffold_431:4430- 8665
Sequence
4235 bases(100 bases per row)
TCGTACAGCAGACCTCCACATGACAGGTTGGATGCTGGTTCCCACGTTGGATCTTCATAACCCACCCACTTGACTTTGAACTCGTACAGCACGCTCCGTG
TTTGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCTCGACTTCATATTAACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAATAGTTCCTCAT
CAAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACCAACCGAGTGTTCGGTCGACTGTTGAACTCGTTGACAGCCTTAGTCTCGCCACATGCACTACT
GGGTAAAAGCGATACCCACTTCGGTCAGGCACTTCCAGCTCGTACGCAAACTCTTCCACCTTGCGCTTGATACGAAAAGGTCCGTGCCACCTGTGAGCTA
ATTTCTTCGTCAAGCTTGGTTTGAGGCGTTCCATGTACAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCAT
CTCTTCCGAAACTTCTGGAGGGTCCGCCGAGTGTTCGTTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGAGCATCATTATGTTTTTTA
GCCCTTCGCTCCTTTTCTACAGCCTGATAGTCTTTGGCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACT
GCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCTCAACGTCGACTGAGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGT
GTCCTGAGAAGTATTAATAGCAAATACCAGCTTCTCTGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACT
GACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCGATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAACACCT
CGCTCATGAAGCGTGGGTCACGGTCGTGCCTTATCAGTGACGGGGCTCTGAACCGTCGGTACACACATTCTTCAAACACTTGGGCAACACTCAGTGCAGT
CGTATCCGACATAGCCTTGGCAATAACGAATCCCGTAAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGAATCACA
AAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGTACGTTGCCGGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTAGAC
ATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGGTGTCCTCCTTC
CAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTCGTCTCCTCTTGCCAACCGTGGTCGTACCGACGA
TTCAATCGAAGATAGTGAAGCACGCCGTCTTCTGATAACACGAACCGGTCAGCATACTTCCAACCATCTCGAGCTTCTTTGTAACTCAGCTCTTGTGCTT
GGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCAGTATTCGTCTGCGTCGTTCCCGTTGTATCGCTACCGGGTCAAC
ATCTTCCGCATCGGGAAATGCCGCTGGTACAGTCTTGTGAGGATGGTCTGGCAAATCTTCGCCGATTGAATCTTCGGTGGACGTCTCTCGTCTTTCTTCA
TGCTGTTCTTGAGCTTTTGAGACATCCTCCGAGTGTTCATCTGCAAACCTGACGCGTTTCTTGGCTTTGGTCTGTCGCCGAGTCATCACTGCCATATTAC
CATAATCGCACTTTGGTAAGCTGTAATCAACCACGAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGC
TCCACGTGACGAAACATCTACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGATTCAGCGACGCCAATTCCGACTTGCGAGTTTCAGCCAAG
ATGACCCGACTGACCTTCGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCT
TGGCCGCGAGTTCCTTGTGAGTATTCAGCAGCGCTAGCTAGGTTTCCTTCCTGCATGCGATCACCCCTAATGATTGTTGAAACGCGAGCCTTGAGTCACC
AACGATGACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGTTTATCATTCCTGTATACTCTGCCTCATTCACCATGGTGGAAGCGTTTGCA
GCAATCACTATCGTCCACTCAGGAAGACTCCACAGCACCCATGAACAACTCCCGTCGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGA
CGAATCCGCTGTAATTACGGGAAAGCCTGGGTACAGCAACGCGGAGTTCATTCGAATAGTCGGGGAACCCTTGTTTAGGGGGGGCCACCGGCGCGAGCGA
GTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGGAGCTGTGCGAAGGCGACATCTTTCTCCTTCACGCGCTGCACCTTCAAATGCCACTGCGAA
AGCAGTACGGCAAACTGGACCGCGCGTCCAAAGAGAGACTTCGACTTGTGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTG
CCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCGGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAG
GAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACCGA
TCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTTCAATTTTTCGAAGGAACGACGTGCCACAGAAAGGTCACTTTCAACGTCAAAGTCCCCAT
CCTTGAGCTGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACT
CGTTGGAAACGAAAGCTCGGTGATAGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGG
CAGAAGATGCTCTTGGTAAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCAC
CGAAGCAAATGTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGATTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTT
GACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGTCCACGACGTTCCTTG
GCCTGTTCTTCAGCTAAACGCATCATCTCCGAGTATTCAAACCAACCTCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGATAGA
TCATCGGTGCGTTCTTTAATCCAAAGGGCATGCGCAACCACTCGAAGTGTCCGAGTGCGCAGACAAACACCGACACTTTACGTGCTCGCAGTGTCATCAT
GACCGCCCAGAAGCCGCTTGCAGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATG
ATTGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGT
CTGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATTGCAGCGGCACGCGTCGGGCACGCTGTTTAATTGG
GGCGTGCCCCTGTGTGTCGATATCGCATACCGCTCCGTAGGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTC
GCGACTAGACGTTCTCGGCGTTCAGTCGACAGCTC