Description :
From Genome Similarity Track
Location :
contig_159:4430- 5439
Transcript NameFunction/comments
g13920.t1hypothetical protein

Sequence
1009 bases(100 bases per row)
TACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATG
GCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAA
TTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTTGGACAAACCGAATTACGGCTTGTCGA
CGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTA
AAGTGTCTACGCCCGTCGTAGACACTGTGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTG
CTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCA
CGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTA
GCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGT
GTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACA
GACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGCCACAATACCAGTCCTCCGCTTGTTGTCTTGCG
GAAGACCAA