Description :
From Genome Similarity Track
Location :
Scaffold_553:443- 1709
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20388pectin lyase

Sequence
1266 bases(100 bases per row)
AGGATGCCCACACCGTAGTTCTGGTTGTTGGTGCTGAGCTTCTGGGCCGACGTCGGCTGGTAGTAGCTAGCCACCTTCTTGGAGTTGGCTAGTGCCGCCG
AGTCACGGTTGCCCGACAGCGTGCCACACTTCACCAGTTTATTCTCGACGCAGTTGCGACCCAGTGTCGACTTGCACGTCGACTGCGTCGACGACGACGG
CACGATGATAGCACCGACGGTCTCGGCGTCGTGCTTGTTCGGCACAGCGGTGGACTCGAAGTAGTTGCCCTCCAGCAGCACGTTACCGTTCTCGACGACG
TCGTACGAGAAACCCGAGTTGCTGTACCAGTAGTTGTTGGCAGCGTGGATGACGGAGTTGCCACCGACCTTGGGGGAGCGACCCGACGTGTGGTGCACGA
AGTTGTTGACAAGACTGGCCTGCGTCTGTGTGCCGAGGAAGAGGAAGGTCCAGTAGTGGTTGCCATCACAAGTAGCTGAGTACTGCGTTTTACCGTCGAA
CTCGGAGTTGCTGATGGTCAGGCTCTTGACGCTGGCAGTATTGGTGGCGATCATCTGGCGACCGATGTTGGAGATCTTGACGTGGTCGATCCACACGCGC
TGCATGGCCGTCTTGCCGCTGTTGAGACCCTGGATGTAGATGGCATCACCTCCCCAGATAAGGTGCGGGTTCAGCTGCGTGATGTGAACGTTCTGGATGA
TAACATTGTCGCCCTGGATCCAGAGGCCCTTGCCCTTGATCACACCACTAGTTCCGACACCGCGGAGAGTCTTGTTGCTCGTGATCACGAGCGGGTTCTT
GGTAGCAGCAAGGTCGTAGGTGACCTTGACGGAGGTGCCCTCGACACAACCGCCCGTGTTGGCCATGCCACCACTTTGCAGGATAACATCCTGGCCCTTG
TATCCGTTGTTCTTGGCGAGGCAATCGCGGTTGCTCTTGGGACGGCAACCATTCTCGGTTGTAGTACCTTCAGTGCCACGGAAGTCGAAGGTCGTTTTGA
GCACGATGACCCGTGGCTGTGAGTCCTTGAGGTAGTTCCTGAGCTCTGCAAGCGAGGTGGGGTATACGGGGTTGGCATTGCCTCCACCCGTGGTGCCAGC
AGCGAGACCGGGGGCAGTACCCGTGGAGAGAGCTTGCGTGCCTTGCATTGCGAATGCAGCGATGGCGACAATGACGAATCGGAAGATCTGCATGGTGTTT
GTGTGCAGGGTGCTGGGACTTGTGCTGTGCGAGGCAAAATCGACAATGAGCAATGAGTGCGGTGGC