Description :
From Genome Similarity Track
Location :
Scaffold_1868:443- 1578
Transcript NameFunction/comments
Phyag_g11643hypothetical protein PHYSODRAFT_329696

Sequence
1135 bases(100 bases per row)
gcccacgaagaagctgccaacCGTGTGCTTCTAGGACAACGCTATCAGCCACTGCGTTGATTCGGATGGGTAGACTATGGCGTACTCAGGTAGTTTTTCA
GATTTGTTTGCTTTCGGGTTGACCACAGTCATTTTAGTCACAACGGTTCCCCCTTCCCAGTTTGCTCCAGCATCTAACGCTTTCCGTAAGCTAAGAGGAA
GATAGCCCTGGCAAAATGAGGCCTTCGAGGATGCCCGGATATCTCTCTCCCATGTGGTCCGAGGCGGAGTTGTCCCGAATGATCGAGGTTTGGAGTGAAC
TGGAAAATAATGGTGTGCGGTTAACGAAGGCAGTAAAGTCTTCGGATGGTCTGGACAAACTCATTGCGGATCGACTCTCGCGAAAAGGAGAAGCGAGATC
CTGTAGGTCTGTCCATACCCAGCGCTGTTATCTGTACGAAGCCGTCCGCTATGTGACGAGATTCAACGAAATGCAGCAAGTCTCTGGTGGTCCGCTTTGG
TTTGACATGACAAAAGAAGAACGAAAGAACGTACACCCGCCAAAACGAGGGAGGCGCACGAGCATCCTTCTCACGAAAGAATCGTTCAACATTTTGGTTA
AAATTAAGTCCGTGAAGAAGTGGACGCGCTCTCCGAAAATTAAAGCGTCTAAGTCCAAAGCTGGAACGAGTTTCGAGTATCGTCATCCGTCGAGGTGTCA
CTCATGCTGGTCTACATCTGAAGCGAGAGCTCTTGCGCATTCCTGGAGTCTCGTCATGAAGAAAACAGGTACTTCGGTTAGAGATTTCGTGGCTCACAGC
TCGGATGACTCGGCAACATTATACACTCCTTGGAGTCATTCAACAGCGAGTGCTTGGCGCAAAATGAAGCGCATCACGACCTCGTATCTATATATCCAAG
CTTTCAATGAGCGCCATGCTCCTGCAAAATGGCACCAGCTCTCGGATGGAGGACAAAGTATGTGGATGGACTGGGATACTCTTCCGGGCGACTTTGAAGA
CATCAGCCTAGAGGTTTTTGACGAGGTGCACAGCGTGGATTTCTCCTCCCCAGAAGAACTGCTTGAAATGGATATTGACCACAAGGTACCTTCTCCAGTA
GGTGACAACTGTCCAAGTCCAGCCGAGAGCGTAGA