Description :
From Genome Similarity Track
Location :
Scaffold_965:443- 1509
Transcript NameFunction/comments
g12883.t1hypothetical protein

Sequence
1066 bases(100 bases per row)
CCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGA
CCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCC
TTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCAAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAAAACGATGC
GCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCA
CAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGGGGGATGCCACTGATGTTCAGGGAGTTG
AGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCCGTCATGCGATCCGCTACGGCTT
CGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACAT
CTCGTCGATCATGCGCCGCATACCTCGCGGAGTAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGT
GGAATCTTCATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCAC
TATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTCCGGATGACTTCAGGCATGCGTCGATTGT
CTCTGTCGCCGAGCCGCCCTTCACCACCGGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCAC